ID: 904575654

View in Genome Browser
Species Human (GRCh38)
Location 1:31503553-31503575
Sequence CCCTTCCCACCCTTGAGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904575654_904575659 -7 Left 904575654 1:31503553-31503575 CCGAAGCTCAAGGGTGGGAAGGG No data
Right 904575659 1:31503569-31503591 GGAAGGGGGAGAACTCAGGATGG No data
904575654_904575660 -6 Left 904575654 1:31503553-31503575 CCGAAGCTCAAGGGTGGGAAGGG No data
Right 904575660 1:31503570-31503592 GAAGGGGGAGAACTCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904575654 Original CRISPR CCCTTCCCACCCTTGAGCTT CGG (reversed) Intergenic
No off target data available for this crispr