ID: 904575659

View in Genome Browser
Species Human (GRCh38)
Location 1:31503569-31503591
Sequence GGAAGGGGGAGAACTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904575654_904575659 -7 Left 904575654 1:31503553-31503575 CCGAAGCTCAAGGGTGGGAAGGG No data
Right 904575659 1:31503569-31503591 GGAAGGGGGAGAACTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904575659 Original CRISPR GGAAGGGGGAGAACTCAGGA TGG Intergenic