ID: 904576580

View in Genome Browser
Species Human (GRCh38)
Location 1:31508964-31508986
Sequence GACCCGGAAGGACACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904576580_904576589 6 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576589 1:31508993-31509015 TGCCTTCCAGATAAGGGGGTGGG No data
904576580_904576588 5 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576588 1:31508992-31509014 GTGCCTTCCAGATAAGGGGGTGG No data
904576580_904576591 11 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576591 1:31508998-31509020 TCCAGATAAGGGGGTGGGATAGG No data
904576580_904576587 2 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576587 1:31508989-31509011 TCAGTGCCTTCCAGATAAGGGGG No data
904576580_904576584 -1 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576584 1:31508986-31509008 CTTTCAGTGCCTTCCAGATAAGG No data
904576580_904576586 1 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576586 1:31508988-31509010 TTCAGTGCCTTCCAGATAAGGGG No data
904576580_904576585 0 Left 904576580 1:31508964-31508986 CCCTGGGAGTGTCCTTCCGGGTC No data
Right 904576585 1:31508987-31509009 TTTCAGTGCCTTCCAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904576580 Original CRISPR GACCCGGAAGGACACTCCCA GGG (reversed) Intergenic
No off target data available for this crispr