ID: 904577140

View in Genome Browser
Species Human (GRCh38)
Location 1:31512193-31512215
Sequence GGCTCACGTGATCCTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904577140_904577144 0 Left 904577140 1:31512193-31512215 CCAACAGGAGGATCACGTGAGCC No data
Right 904577144 1:31512216-31512238 CAGCAGTTTAAGGCCAGCCTAGG No data
904577140_904577141 -10 Left 904577140 1:31512193-31512215 CCAACAGGAGGATCACGTGAGCC No data
Right 904577141 1:31512206-31512228 CACGTGAGCCCAGCAGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904577140 Original CRISPR GGCTCACGTGATCCTCCTGT TGG (reversed) Intergenic
No off target data available for this crispr