ID: 904577141

View in Genome Browser
Species Human (GRCh38)
Location 1:31512206-31512228
Sequence CACGTGAGCCCAGCAGTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904577140_904577141 -10 Left 904577140 1:31512193-31512215 CCAACAGGAGGATCACGTGAGCC No data
Right 904577141 1:31512206-31512228 CACGTGAGCCCAGCAGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904577141 Original CRISPR CACGTGAGCCCAGCAGTTTA AGG Intergenic
No off target data available for this crispr