ID: 904578903

View in Genome Browser
Species Human (GRCh38)
Location 1:31525006-31525028
Sequence GGAGGGAAACAAATTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904578898_904578903 1 Left 904578898 1:31524982-31525004 CCAAAGGAGCTGGAAACCAGAAA No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data
904578895_904578903 10 Left 904578895 1:31524973-31524995 CCCCAAATGCCAAAGGAGCTGGA No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data
904578893_904578903 11 Left 904578893 1:31524972-31524994 CCCCCAAATGCCAAAGGAGCTGG No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data
904578896_904578903 9 Left 904578896 1:31524974-31524996 CCCAAATGCCAAAGGAGCTGGAA No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data
904578890_904578903 28 Left 904578890 1:31524955-31524977 CCTTATATCCAAAATGACCCCCA No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data
904578897_904578903 8 Left 904578897 1:31524975-31524997 CCAAATGCCAAAGGAGCTGGAAA No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data
904578891_904578903 20 Left 904578891 1:31524963-31524985 CCAAAATGACCCCCAAATGCCAA No data
Right 904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904578903 Original CRISPR GGAGGGAAACAAATTCAGTT TGG Intergenic
No off target data available for this crispr