ID: 904581139

View in Genome Browser
Species Human (GRCh38)
Location 1:31545110-31545132
Sequence TCTAATTTGCAGGCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904581139_904581146 15 Left 904581139 1:31545110-31545132 CCTCCCAAAGCCTGCAAATTAGA No data
Right 904581146 1:31545148-31545170 CCTTACCCCTCAGAAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904581139 Original CRISPR TCTAATTTGCAGGCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr