ID: 904583661

View in Genome Browser
Species Human (GRCh38)
Location 1:31566588-31566610
Sequence CTTGTTGGACGGATCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904583652_904583661 11 Left 904583652 1:31566554-31566576 CCAAGTCAGTTAACCTAATGTTA No data
Right 904583661 1:31566588-31566610 CTTGTTGGACGGATCTGACTGGG No data
904583655_904583661 -2 Left 904583655 1:31566567-31566589 CCTAATGTTAGGGAGATCACCCT No data
Right 904583661 1:31566588-31566610 CTTGTTGGACGGATCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904583661 Original CRISPR CTTGTTGGACGGATCTGACT GGG Intergenic
No off target data available for this crispr