ID: 904587453

View in Genome Browser
Species Human (GRCh38)
Location 1:31588133-31588155
Sequence GTGCTGGCACTGGGAATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904587453_904587460 7 Left 904587453 1:31588133-31588155 CCTCAGATTCCCAGTGCCAGCAC 0: 1
1: 0
2: 3
3: 26
4: 337
Right 904587460 1:31588163-31588185 CAGGCCTCAGCCTGGCTCCAAGG 0: 1
1: 0
2: 6
3: 73
4: 489
904587453_904587458 -1 Left 904587453 1:31588133-31588155 CCTCAGATTCCCAGTGCCAGCAC 0: 1
1: 0
2: 3
3: 26
4: 337
Right 904587458 1:31588155-31588177 CAATAAGCCAGGCCTCAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904587453 Original CRISPR GTGCTGGCACTGGGAATCTG AGG (reversed) Intergenic
900370337 1:2329430-2329452 GGGAGGGCACTGGGAAGCTGGGG - Intronic
900919194 1:5660012-5660034 CTGCTGGCACAGGGCAGCTGAGG + Intergenic
901813113 1:11778920-11778942 GTGGGGGCCCTGGGAACCTGGGG - Exonic
902780534 1:18701992-18702014 GTGCTGGGACAGGGCTTCTGGGG - Intronic
902830480 1:19009244-19009266 ATGCTGGTACTGTGGATCTGGGG - Intergenic
904275284 1:29379788-29379810 GTTCATGCCCTGGGAATCTGTGG + Intergenic
904587453 1:31588133-31588155 GTGCTGGCACTGGGAATCTGAGG - Intergenic
905166150 1:36084391-36084413 CTGTTGGCACTGGGGAGCTGGGG - Intronic
905233337 1:36529259-36529281 CTGCTGGCACTGTGACTGTGTGG + Intergenic
906369562 1:45241204-45241226 GGGCTGGCATTGAGTATCTGTGG + Intronic
906992661 1:50755478-50755500 GGGCTGGCACTGAGTGTCTGTGG + Intronic
907395958 1:54190067-54190089 CTGTTGGCTCTGTGAATCTGAGG - Intronic
908587020 1:65580907-65580929 GTGGTGGGACTGGGAAGCTGGGG + Intronic
909574602 1:77159515-77159537 GGGCTGGCATTGAGAGTCTGTGG - Intronic
910357526 1:86377338-86377360 AGGCTGGCACTGAGTATCTGTGG + Intronic
910744551 1:90559159-90559181 GTGCTGGCAGTAGGAACATGTGG + Intergenic
910774483 1:90861653-90861675 GGGCTGGCATTGGGTGTCTGTGG + Intergenic
911515744 1:98866315-98866337 GGGCTGGCATTGAGTATCTGTGG + Intergenic
912938194 1:114021923-114021945 GTCCTGGCACTAGGAATGTAAGG - Intergenic
913090347 1:115472581-115472603 GTCCTGGCAGTGGGGCTCTGAGG - Intergenic
913316557 1:117558674-117558696 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
916268786 1:162918659-162918681 GTCCTGGCACTAGGAATGTAAGG + Intergenic
916618744 1:166472842-166472864 GGGCTAGCACTGAGTATCTGTGG + Intergenic
917152085 1:171956539-171956561 GGGCTGGCATTGGGTGTCTGTGG + Intronic
919869505 1:201809768-201809790 GTCCAGGCACTGGGATCCTGGGG + Intronic
920649042 1:207823218-207823240 GGTCTGGCCCTGGGATTCTGAGG - Intergenic
922124397 1:222708618-222708640 ATCCTAGCACTGGGAAGCTGAGG - Intronic
922520737 1:226249625-226249647 ATAGTGGCACTGGGAATCTCTGG - Intronic
922660752 1:227428712-227428734 GAGCTGGCACTGTGAAGCTCAGG - Intergenic
924010419 1:239659295-239659317 CTGCTGTTACTGGGAATCTTGGG - Intronic
924389532 1:243537797-243537819 CTGGAGGAACTGGGAATCTGTGG - Intronic
1063971734 10:11385799-11385821 GTCCTAGGACTGGGAGTCTGAGG + Intergenic
1065920170 10:30386359-30386381 GTAATGGCACTGAGAATCTCAGG + Intergenic
1067159161 10:43808105-43808127 GAGCTGCCACTGGAAACCTGTGG - Intergenic
1067432943 10:46255888-46255910 TTGCTGGCCCTGGGAAGCCGGGG - Intergenic
1070553947 10:77514000-77514022 GTGCTGGCACTGGGAGTGACAGG - Intronic
1070803556 10:79257236-79257258 CTGCTGTCACCAGGAATCTGAGG - Intronic
1070974454 10:80595231-80595253 GTGCTGGCATTGCTACTCTGAGG - Intronic
1071395442 10:85218942-85218964 GGGCTGGCATTGAGTATCTGTGG - Intergenic
1073540800 10:104315164-104315186 GTCCAGGTACAGGGAATCTGTGG + Exonic
1074401035 10:113141347-113141369 GTGCTGGTCCTGGGGTTCTGGGG + Intronic
1074713097 10:116193705-116193727 GGGCTGGCACAGGTAATCTGGGG - Intronic
1074937721 10:118202579-118202601 GAGGTGGAACTGAGAATCTGGGG - Intergenic
1075004509 10:118820405-118820427 GGGGTGGTACTGGGATTCTGGGG - Intergenic
1075375620 10:121975636-121975658 ATGATGGCACAGGGAAACTGAGG - Intergenic
1076050524 10:127329540-127329562 GTGCTGGGGCGGGGACTCTGGGG + Intronic
1076704221 10:132292645-132292667 GGGCTGGCACCGGGAATCTGTGG - Intronic
1076778547 10:132711249-132711271 GGGCTGTCACTGGGAAGCAGGGG + Intronic
1077104159 11:834749-834771 GGGCGGGCACGGGGCATCTGGGG + Intronic
1077230495 11:1456342-1456364 TGGCTGAGACTGGGAATCTGTGG - Exonic
1078482266 11:11687791-11687813 GGGCTGGCATTGAGCATCTGTGG - Intergenic
1078646317 11:13143825-13143847 GAGCTGGCACTGGGGAGCTGTGG + Intergenic
1078916342 11:15782227-15782249 GTGGGGGCACTGGATATCTGTGG + Intergenic
1080781556 11:35434481-35434503 GGGCTTGCACTTGGAAGCTGGGG - Intronic
1080877252 11:36288079-36288101 GAGCTGGGACTGGCAATCTAGGG - Intronic
1081388716 11:42503623-42503645 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
1081737584 11:45414796-45414818 GTGCTGGAAGTGGGTACCTGGGG - Intergenic
1081746740 11:45478407-45478429 GGGCTGGCAGTGGGACTCAGTGG + Intergenic
1081862622 11:46342178-46342200 GTGCCAGCCCTGGGAAGCTGGGG - Intronic
1082652049 11:55805987-55806009 GTGCTGTCACTGAGTGTCTGTGG + Intergenic
1083651867 11:64208730-64208752 GTGGTGGCGCTGGGACTCGGAGG + Intronic
1085339924 11:75724428-75724450 GTGCAGGCACTTGGATACTGAGG - Intronic
1086288014 11:85271542-85271564 GTGCTGGCATTGAGTGTCTGTGG - Intronic
1086620700 11:88884133-88884155 GAGCTGGCATTGAGTATCTGTGG - Intronic
1087893295 11:103559554-103559576 AGGCTGGCAATGGGAATTTGGGG - Intergenic
1088029850 11:105234857-105234879 GACCTTGAACTGGGAATCTGGGG + Intergenic
1088975855 11:114815976-114815998 GTGCTGGAGCTGGGGAGCTGGGG - Intergenic
1089619665 11:119714895-119714917 GAGCTGTTACTGGGGATCTGAGG + Intronic
1089766036 11:120766342-120766364 GTGCTGGCAGCGGGAATTTCAGG + Intronic
1089778903 11:120859436-120859458 CAGCTGCCACTGTGAATCTGTGG + Intronic
1090647668 11:128778727-128778749 GTGCTGGCATCGGGAAGGTGGGG + Intronic
1091025548 11:132137794-132137816 GTTCTGCCACTGGGAAGCAGTGG - Intronic
1093585766 12:20834745-20834767 CAGCTGGCATTGGGTATCTGTGG + Intronic
1098293152 12:68978167-68978189 TTGCTGGCTCTGGGTCTCTGGGG - Intergenic
1098583184 12:72125905-72125927 GAGATGGAACTGAGAATCTGGGG + Intronic
1098583346 12:72127942-72127964 GAGATGGAACTGAGAATCTGGGG + Intronic
1099422003 12:82473230-82473252 GAGCTGGCACTGGGGTTATGGGG + Intronic
1099621322 12:85005741-85005763 GTGCTGGCATTGAGTGTCTGTGG - Intergenic
1100667321 12:96769078-96769100 ATGTTGGCACTGGCAATGTGGGG + Intronic
1104316060 12:127702690-127702712 AAACTGCCACTGGGAATCTGGGG + Intergenic
1105363995 13:19747581-19747603 ATTCTAGCACTGGGAAGCTGAGG - Intronic
1105883856 13:24625960-24625982 GTGCTTGCACTGGCACTGTGGGG - Intergenic
1106036110 13:26046886-26046908 GTGCTGGCACTGGGGATCATGGG + Exonic
1106074041 13:26441967-26441989 GTGCTGCTTCTGGGAAACTGGGG + Intergenic
1106218696 13:27726117-27726139 GTGCCTGCTCTGGGAATCTCTGG + Intergenic
1106678361 13:31984985-31985007 GGGCTGGCACTGAGTGTCTGTGG - Intergenic
1107064230 13:36195402-36195424 GCTCTGGCACAGGGCATCTGAGG + Intronic
1108918592 13:55648126-55648148 GGGCTGGAGCTGGGAATTTGAGG + Intergenic
1110626859 13:77662475-77662497 GTGCCTGCGCCGGGAATCTGGGG - Intergenic
1112880047 13:104095933-104095955 GTTCTGGCACTTGGCATCTTGGG + Intergenic
1113573739 13:111379918-111379940 GTCCTGGAAGTGGGTATCTGAGG + Intergenic
1113793321 13:113042120-113042142 GTGCGGGCACAGGGCATGTGTGG - Intronic
1114205158 14:20564026-20564048 GTCCTGGCACTAGGAATGTAAGG - Intergenic
1114500676 14:23166020-23166042 GTGCTTTCTCTGGGAATCTATGG + Intronic
1114612888 14:24053804-24053826 GTGAGGGCACTGGGCATGTGGGG + Intronic
1115009136 14:28522796-28522818 GAGCTGGCATTGAGTATCTGTGG - Intergenic
1119245274 14:73099385-73099407 GTGGGGCCACTGGAAATCTGCGG - Exonic
1120759813 14:88275115-88275137 GTGCTGTCAGTGTGACTCTGGGG + Intronic
1121021651 14:90583978-90584000 GTGCTTGCCCTGGGTTTCTGGGG - Intronic
1122062114 14:99143087-99143109 GTCCCTGCACTGGGAAACTGGGG + Intergenic
1122145204 14:99684569-99684591 GTGCTGGGACTGGGGGCCTGGGG + Intronic
1122325897 14:100880489-100880511 GGGCTGGCGCTGGGTCTCTGAGG + Intergenic
1122470620 14:101963755-101963777 GAGCTGGCACTGTCATTCTGTGG - Intergenic
1123661861 15:22571677-22571699 GTCCTGGCCCTGGGCAGCTGGGG + Intergenic
1124262349 15:28203868-28203890 GTCCTGGCCCTGGGCAGCTGGGG - Intronic
1124315660 15:28665920-28665942 GTCCTGGCCCTGGGCAGCTGGGG + Intergenic
1124779367 15:32615513-32615535 GTGGTGGCTCTGGGTGTCTGCGG + Exonic
1125919754 15:43518398-43518420 GGGCTGAGACTGGGAACCTGTGG - Intronic
1126110653 15:45172875-45172897 GTGCTGCCTCTGGGCCTCTGTGG - Intronic
1126232755 15:46345916-46345938 GTGGTTGCACTGTGAATGTGAGG - Intergenic
1126256126 15:46627590-46627612 GGGCTGGCACTGAGTGTCTGTGG - Intergenic
1128790428 15:70429486-70429508 GTTAAGTCACTGGGAATCTGGGG + Intergenic
1130545517 15:84855350-84855372 ATGCAGACACTGGGAAGCTGAGG - Intronic
1130919568 15:88332864-88332886 GTGCAGGCAGTGGGGATCTATGG - Intergenic
1130983446 15:88828737-88828759 GAGCTGGCATTTGGAATCTCAGG + Intronic
1132625344 16:888938-888960 GCGCTGGCCCTGGGATCCTGGGG + Intronic
1132674626 16:1116617-1116639 GTGCTGGCGGTGGGCATGTGAGG - Intergenic
1134476127 16:14575301-14575323 GTGCTGGCATTGAGTGTCTGTGG - Intronic
1134490370 16:14691588-14691610 CTGCTGGCTGTGGGAATGTGGGG - Intronic
1134495751 16:14730705-14730727 CTGCTGGCTGTGGGAATGTGGGG - Intronic
1134501297 16:14771016-14771038 CTGCTGGCTGTGGGAATGTGGGG - Intronic
1134579284 16:15358018-15358040 CTGCTGGCTGTGGGAATGTGGGG + Intergenic
1134723298 16:16399536-16399558 CTGCTGGCTGTGGGAATGTGGGG - Intergenic
1134944130 16:18312334-18312356 CTGCTGGCTGTGGGAATGTGGGG + Intergenic
1135323475 16:21511971-21511993 GTGCTGCCACAGGGCCTCTGGGG + Intergenic
1135639262 16:24106402-24106424 TTATGGGCACTGGGAATCTGGGG - Intronic
1136165554 16:28450682-28450704 CTGCTGGCTGTGGGAATGTGGGG + Intergenic
1136197418 16:28664327-28664349 CTGCTGGCTGTGGGAATGTGGGG - Intergenic
1136213757 16:28778474-28778496 CTGCTGGCTGTGGGAATGTGGGG - Intergenic
1136258491 16:29058398-29058420 CTGCTGGCTGTGGGAATGTGGGG - Intergenic
1136320004 16:29477918-29477940 CTGCTGGCTGTGGGAATGTGGGG + Intergenic
1136334963 16:29605236-29605258 GTGCTGCCACAGGGCCTCTGGGG + Intergenic
1136434574 16:30217259-30217281 CTGCTGGCTGTGGGAATGTGGGG + Intergenic
1137394397 16:48106619-48106641 GTGGTGGCACTGGGGAGATGGGG - Intronic
1137547308 16:49413383-49413405 TGCCAGGCACTGGGAATCTGGGG - Intergenic
1138417109 16:56877907-56877929 GTGCTGGAACAGGGGCTCTGAGG + Intronic
1138829515 16:60359551-60359573 GTGCCTGCCCGGGGAATCTGGGG - Exonic
1139967175 16:70752241-70752263 GTGCTGTCACTGTTAATCAGTGG - Intronic
1140428769 16:74883844-74883866 GGGCTAGAACTGGGAATTTGGGG - Intronic
1140566505 16:76049043-76049065 GTGCTGGCAAAGGGGTTCTGGGG + Intergenic
1142035677 16:87861055-87861077 GTGCTGCCACAGGGCCTCTGGGG + Intronic
1142435638 16:90055184-90055206 GGGCTGGCATTGAGAAGCTGAGG - Intergenic
1143699979 17:8651212-8651234 CTGCTGGCAGTGGGAAGCTTTGG + Intergenic
1143836240 17:9695158-9695180 GGGCTGGGACTGGGATTGTGGGG - Intronic
1144790762 17:17857567-17857589 TTTTTGGGACTGGGAATCTGTGG + Intronic
1146957233 17:36942746-36942768 GTACTCGCTCTGGTAATCTGCGG - Exonic
1147559483 17:41500123-41500145 CTGTTGGCAATGGGAGTCTGAGG + Intergenic
1148097649 17:45064394-45064416 ATTCTGGCACTAAGAATCTGGGG + Intronic
1149260759 17:54877363-54877385 GAGCTGGCAGTGGGTGTCTGCGG - Intergenic
1149600909 17:57892420-57892442 GTGCTGGCAATTGGGACCTGTGG - Intronic
1150622722 17:66820537-66820559 GGGCTGGCGCTGGAAATCTCTGG + Intergenic
1152575352 17:81137594-81137616 GTCCTGGCCCTTGGCATCTGGGG - Intronic
1152710296 17:81867903-81867925 GTGGTGGCACTGAGAGCCTGGGG + Exonic
1153973809 18:10249210-10249232 ATGCTGGCAATGGGAAACGGAGG - Intergenic
1155231955 18:23782900-23782922 GTGCTGGCCCTGGGGGCCTGTGG + Intronic
1156062000 18:33089699-33089721 GTGCAGGCACAAAGAATCTGGGG + Intronic
1156084558 18:33382922-33382944 GTGCTGGCAGTGGGAATTTCAGG - Intronic
1156153107 18:34266685-34266707 GGGCTGGCATTGGGTGTCTGTGG - Intergenic
1158197951 18:54909717-54909739 GTGCTGGCTCTGCGAGGCTGCGG + Intronic
1159847463 18:73480564-73480586 GTACTGGAAGTGGGAATCTGAGG + Intergenic
1161272654 19:3398575-3398597 GTGCTGTCTCTGGGAATCCCAGG + Intronic
1163083601 19:14962420-14962442 GTGTGGGAACTGGGAATCAGTGG - Intronic
1164659138 19:29948296-29948318 GTGCTGGTAGTGGGCATCAGGGG + Intronic
1164966502 19:32489444-32489466 GTTCAGGCAGTGGGAATCTTGGG + Intergenic
1165313558 19:35041887-35041909 GGGCTGGAACTGTGAGTCTGGGG - Exonic
1166111513 19:40626070-40626092 GTTCTGCGACTGGGGATCTGAGG - Intronic
1166819661 19:45569847-45569869 GTGGTGTCATTGGGAACCTGAGG - Intronic
1167707503 19:51090303-51090325 ATGCTGGGACTGGGGAGCTGAGG + Intergenic
1167942923 19:52962281-52962303 GTCCTGGCTCTGGGAATCTAAGG + Intronic
925408357 2:3624227-3624249 ATGCTGGCACTTGCCATCTGTGG + Intronic
925443496 2:3908225-3908247 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
926068796 2:9867319-9867341 TTGCTGGCAGTGGTAACCTGTGG + Intronic
926138068 2:10351392-10351414 GGGCTGGGACTGGGAGGCTGAGG + Intronic
926502436 2:13673077-13673099 GTGCTGGCATTGAGTTTCTGTGG + Intergenic
926895443 2:17682437-17682459 GAGCTGGAGCTGGGAATCTGGGG + Intronic
927074438 2:19563890-19563912 GTGCTGGGACTCTAAATCTGGGG - Intergenic
928332275 2:30366754-30366776 GTGCAGGAACTGGGACCCTGAGG - Intergenic
931046769 2:58362742-58362764 GTGATGGGCCTGGGAAGCTGTGG - Intergenic
931470754 2:62535963-62535985 GCCCTGGCTCTGGGAAACTGGGG - Intergenic
932068492 2:68591829-68591851 GTCTGGGCACTGGGAATCTGGGG - Intronic
932211704 2:69936999-69937021 GTCCTGTCACAGGGATTCTGGGG - Intronic
933006747 2:77004722-77004744 GTGCTGGCAGTGAGTGTCTGTGG - Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934151012 2:89147559-89147581 GTCCTGGCACTAGGAATGTAAGG - Intergenic
934216261 2:90034464-90034486 GTCCTGGCACTAGGAATGTAAGG + Intergenic
936082838 2:109446645-109446667 GTGCTGGCACTGTGCCTCTGAGG + Intronic
936146008 2:109981080-109981102 GTGCTGGCAGTAGGAATAAGAGG - Intergenic
936198681 2:110390398-110390420 GTGCTGGCAGTAGGAATAAGAGG + Intergenic
936302607 2:111315647-111315669 GAGCAGGCACTGGGAGCCTGGGG + Intergenic
936341892 2:111641028-111641050 GTACTGGGACTGGGGACCTGGGG - Intergenic
936813604 2:116432898-116432920 GGGCTGGCATTGGGTGTCTGTGG + Intergenic
938812785 2:134869127-134869149 TTGATGGCACTGGGCATCTTGGG - Intronic
941227181 2:162864845-162864867 GAGCTGGCATTGAGCATCTGTGG + Intergenic
941928337 2:170917350-170917372 GTGCTGGCACTTGGAATGGCTGG - Intergenic
944265769 2:197724377-197724399 GTGTCTGGACTGGGAATCTGAGG - Intronic
945084838 2:206120546-206120568 GTCCAGGCCCTAGGAATCTGTGG + Intronic
946021509 2:216643526-216643548 GTACTGCCATTGGGAATCCGGGG + Intronic
946026068 2:216672690-216672712 GAGCGGGCACAGGGAAGCTGGGG + Exonic
946905764 2:224414583-224414605 GGGCATGCACTGGGAATGTGGGG - Intergenic
947349200 2:229225120-229225142 GAGCTTGGACTGGGAGTCTGAGG + Intronic
947510766 2:230752422-230752444 GTGCTGGCATTCAGAGTCTGAGG + Intronic
948486223 2:238282984-238283006 AGGCTGGCACTGGGCATCTCTGG + Intronic
948904763 2:240973559-240973581 AGGCTGGCACTGGGGATGTGGGG - Intronic
949021671 2:241744375-241744397 GTGCTGGTACTGTGAGTCGGAGG - Intronic
1169461248 20:5797594-5797616 GTGCTGGGACTGGGACTATATGG - Intronic
1173409324 20:42795611-42795633 GTGCTGGCACTGGGAGCTGGCGG - Intronic
1174186372 20:48709024-48709046 GAGCTGGCAGTGGGAAACGGTGG - Intronic
1175148174 20:56912256-56912278 GGGCTGGCACTGGGCAACAGGGG + Intergenic
1175182473 20:57158296-57158318 GTGTTGGCAGGGGGTATCTGTGG - Intergenic
1175462711 20:59165128-59165150 GTGCTTCCGCTGGGAAGCTGGGG + Intergenic
1176004056 20:62850094-62850116 ATCATGGCACTGGGATTCTGTGG + Intronic
1176061466 20:63174649-63174671 CAGCTGGAACTGGGAAGCTGTGG + Intergenic
1177306013 21:19317094-19317116 GGGCTGGCATTGAGTATCTGTGG + Intergenic
1177981099 21:27915746-27915768 GGGCTGGCACTGAGTGTCTGTGG - Intergenic
1178390088 21:32191196-32191218 GTGGGGGCACTGGGAATTTATGG - Intergenic
1178864451 21:36316565-36316587 GTGCTGGCAGTGAGAATTTCAGG + Intergenic
1179180902 21:39043994-39044016 GTCCAGGCACTGGGACTCTGAGG - Intergenic
1181327422 22:22060758-22060780 GGGCTGGCACTTAGAGTCTGTGG + Intergenic
1181512417 22:23394843-23394865 GCGCAGCCACTGGGCATCTGGGG - Intergenic
1182296103 22:29311865-29311887 CTGCGGGCACGGGGAGTCTGGGG - Intronic
1182960959 22:34474748-34474770 GAGGTGGCACTGGGCATCTCAGG + Intergenic
1183277106 22:36905567-36905589 GAGCTGGACCTTGGAATCTGTGG - Intergenic
1185100514 22:48838549-48838571 GTGCTGCCCCTGGAAATCTCGGG + Intronic
1185206926 22:49545102-49545124 GAGCTGAGACTGGGAACCTGGGG + Intronic
949864031 3:8532635-8532657 GTGCTGGCAAAGGGACTGTGTGG - Intronic
950086172 3:10259578-10259600 GTGCAGTCACTGAGAAACTGAGG + Intronic
951055279 3:18140006-18140028 GTGATGGTACTGGGGATCTCAGG + Intronic
951957733 3:28275688-28275710 CTGCTGGCTCTGAGAAACTGGGG - Intronic
953387182 3:42513292-42513314 GGGCTGGCCCTGGGAACCAGAGG + Intronic
953681746 3:45044154-45044176 TTGCTGGCTCTGTGACTCTGTGG + Intergenic
956888580 3:73586488-73586510 GTGCTAGTACTGAGAATATGCGG + Intronic
956889553 3:73598667-73598689 GGGCTGTGGCTGGGAATCTGGGG - Intronic
957676730 3:83377202-83377224 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
961006916 3:123411629-123411651 GTGCTGGGCCTGGCACTCTGTGG - Intronic
961380627 3:126494476-126494498 CTGTTGGCACGGGGACTCTGAGG + Intronic
961677859 3:128578473-128578495 GTGCTGGCTCTGGAACCCTGGGG - Intergenic
962089640 3:132229904-132229926 GTGCTGGGAGTGGGTGTCTGGGG - Intronic
962509532 3:136084634-136084656 GGGCTGGCATTGAGTATCTGTGG - Intronic
963019671 3:140860674-140860696 GTGCTGGCACTAGGAATCTCTGG + Intergenic
963386178 3:144598023-144598045 GGGCTGGCATTGGGTATCTGTGG + Intergenic
963516570 3:146316627-146316649 GTGCTGGCATTGAGTGTCTGTGG + Intergenic
964109817 3:153076636-153076658 GTGCTGGCTTTGGGAGTCTTAGG - Intergenic
965729969 3:171761363-171761385 GTGCTGGCTCTAGGAAACTCAGG - Intronic
966590337 3:181675092-181675114 CTGCTGCCTCTGGGAATCTGAGG - Intergenic
967768935 3:193312897-193312919 TTGCTTGCACTGGGAATGTGGGG + Intronic
967980249 3:195061211-195061233 GTCCTGGCACTGGGCATGGGCGG - Intergenic
968604901 4:1530503-1530525 GTGCTGGGGCTGGGGCTCTGGGG + Intergenic
968981755 4:3853923-3853945 GTGCTGGCACTGGGCATGTGCGG - Intergenic
970246523 4:14070309-14070331 GTGCTGGAGCTGGGAAGCCGAGG + Intergenic
970721795 4:18997050-18997072 GGGCTGGCATTGGGTGTCTGAGG + Intergenic
970897272 4:21118437-21118459 TTGTTGGCACAGGGAAGCTGAGG - Intronic
971119686 4:23689757-23689779 ATGCTGGCATTGAGTATCTGTGG - Intergenic
972200272 4:36705968-36705990 CAGCTGTTACTGGGAATCTGAGG - Intergenic
972584520 4:40425098-40425120 GCGGTGGGATTGGGAATCTGGGG + Exonic
973078562 4:45961799-45961821 GGGCTGGCACTGAGGGTCTGTGG + Intergenic
974171398 4:58271008-58271030 GGGCTGGCATTGAGTATCTGTGG - Intergenic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
977678224 4:99771076-99771098 GTGCTAGCAGTGAGACTCTGTGG + Intergenic
979464607 4:121022037-121022059 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
979649648 4:123114879-123114901 GTGCTGCCACTGGGACTCACAGG - Intronic
980396523 4:132222951-132222973 GTCCTTGCTCTAGGAATCTGTGG + Intergenic
980786340 4:137561111-137561133 GTGCTGAGACTGGGAAACTGTGG - Intergenic
981615020 4:146637331-146637353 GTGCAGGCACTGGGCGCCTGGGG - Intergenic
982299930 4:153868027-153868049 GGGCTGGCATTGAGCATCTGTGG - Intergenic
983320680 4:166192103-166192125 GGGCTGGCATTGGGTATCTGTGG - Intergenic
983322362 4:166211429-166211451 GGGCTGGCATTGAGTATCTGTGG + Intergenic
984416976 4:179474037-179474059 CTTTGGGCACTGGGAATCTGTGG + Intergenic
985333877 4:188870750-188870772 GTGCTATCACTGGGAATGAGAGG - Intergenic
985708202 5:1413815-1413837 GTGCTTGCAGTGGAAAGCTGTGG - Intronic
986008979 5:3695057-3695079 GAGCTGCCACTGGGAATGGGTGG + Intergenic
986505086 5:8441405-8441427 TTGCTGGTACTGGGAATTTTGGG + Intergenic
988740069 5:34061296-34061318 GGGCTGGCACTGAGTATCTGTGG + Intronic
990731278 5:58811808-58811830 GTAATGGCAGTGGGAACCTGTGG - Intronic
991581889 5:68164244-68164266 GTGGTGGCTTTGGGAAGCTGAGG - Intergenic
995111615 5:108435284-108435306 GTCCTAACACTGGGAGTCTGAGG - Intergenic
996046711 5:118882350-118882372 GGGCTGGCATTGAGTATCTGTGG + Intronic
997528214 5:134566960-134566982 GAGCTTGCATTGAGAATCTGAGG + Intronic
997627203 5:135339223-135339245 GCACTGGCCCTGGGAAACTGAGG - Intronic
997631230 5:135370203-135370225 TTCCTGGCACTGTGAATGTGGGG - Intronic
998370408 5:141656983-141657005 GTGCTGGCCCTGGGATACGGTGG + Intronic
999445770 5:151638042-151638064 CTTCTGGCTCTGAGAATCTGTGG - Intergenic
999941203 5:156545315-156545337 GTGCTGGGATTAGAAATCTGAGG - Intronic
1000233119 5:159333696-159333718 ATGCTGGCACTGGTAACCTCTGG - Intergenic
1001338940 5:170825942-170825964 GGATAGGCACTGGGAATCTGTGG - Intergenic
1002139230 5:177128708-177128730 GTCCTGGCACTGGGCAGTTGGGG + Intergenic
1002571022 5:180139458-180139480 GAGCTGACACTGGGGATCAGAGG + Intronic
1002573064 5:180154993-180155015 GTGCTGGCACTGGGAGCTGGGGG + Intronic
1002816953 6:690102-690124 GTCCCAGCACTGGGAAGCTGAGG + Intronic
1003227397 6:4218648-4218670 GGGCTGGCATTGAGTATCTGTGG + Intergenic
1004676919 6:17851820-17851842 GTGCTGATACTGGGTTTCTGAGG + Intronic
1005804560 6:29462183-29462205 GTGCTGGCAGCTGGCATCTGTGG + Exonic
1005818154 6:29574315-29574337 GTGCTGGCAGCTGGCATCTGTGG + Intronic
1005819788 6:29588358-29588380 GTGCTGGCAGCTGGCATCTGTGG + Exonic
1006178753 6:32140656-32140678 GTCCTGGCACTAGGAATGTAAGG + Intergenic
1006667544 6:35707085-35707107 GGGATGGGACTGGGAATCTAGGG + Intronic
1008434912 6:51464741-51464763 ATGATGGAACTGAGAATCTGAGG + Intergenic
1010187164 6:73157473-73157495 GAGTTGGTTCTGGGAATCTGTGG - Intronic
1010263795 6:73845297-73845319 GGGCTGGCACTGAGTGTCTGTGG - Intergenic
1010765048 6:79769539-79769561 GCGCAGGCACTGAGAATCTGGGG + Intergenic
1012420685 6:99061675-99061697 TTGCTTGAACTGAGAATCTGAGG - Intergenic
1013606009 6:111749141-111749163 GTGCTGACATTTGGAATCTGTGG + Intronic
1013915903 6:115336588-115336610 GGGCTGGCATTGAGAGTCTGTGG - Intergenic
1013927824 6:115494238-115494260 GGGCTGGCACTGGGTGTCTGTGG + Intergenic
1014166540 6:118231400-118231422 GTGCTGGCATGGGGACTCTAAGG + Intronic
1015004595 6:128263852-128263874 GAGGTGGCACTGGGACTCTAAGG + Intronic
1015238912 6:131002183-131002205 GTGCTGGCACTGGTGATCGAAGG - Intronic
1015764047 6:136696943-136696965 CTGCTGGCACAGCGAACCTGTGG - Intronic
1019734561 7:2644395-2644417 GTGCTGGGACTGTTAATATGAGG + Intronic
1020729726 7:11866298-11866320 GTGCTGGCATTGAGTGTCTGTGG - Intergenic
1021623969 7:22574746-22574768 TTGCGGGCACTGGGAGGCTGAGG - Intronic
1021762310 7:23913699-23913721 GGGCTGGCACTGAGTGTCTGTGG - Intergenic
1021963050 7:25891744-25891766 GTCCTTCCACTGAGAATCTGTGG + Intergenic
1024197808 7:47076699-47076721 GTGCTAGGAGTGGGAATATGTGG - Intergenic
1024339435 7:48242364-48242386 TTCCTGGCACTGAGAATGTGTGG - Intronic
1024721143 7:52138809-52138831 GAGCTGGCATTGGGAGCCTGTGG + Intergenic
1024844002 7:53620766-53620788 GGGCTGGCATTGAGTATCTGTGG - Intergenic
1025909192 7:65813861-65813883 ATTCTGGCACTGGGAAACTTGGG - Intergenic
1030255639 7:107506638-107506660 ATGCTGCTACTGGGAAACTGTGG - Intronic
1031583428 7:123505224-123505246 GAGCTGGCACTGAGTGTCTGCGG + Intronic
1031783342 7:125997819-125997841 GGGCTGGCACTGAGTGTCTGTGG - Intergenic
1033633508 7:143185360-143185382 GTGGTGTCACTGGGTATCTGGGG + Intergenic
1033721134 7:144060495-144060517 GTGCTGGCATTGAGTGTCTGTGG - Intergenic
1035558145 8:582566-582588 GTGCTGGTACTGGGTATTTTTGG - Intergenic
1036431670 8:8697913-8697935 GACCTGGCAGAGGGAATCTGAGG + Intergenic
1038373100 8:27012220-27012242 GTGCCTGCCCCGGGAATCTGGGG - Intergenic
1039674998 8:39653015-39653037 GGGCTGGGAGTGGGAAACTGGGG + Intronic
1040540128 8:48346436-48346458 GTGCTGGCACTGAGTGTCTGAGG - Intergenic
1040545165 8:48393325-48393347 CTGCTGCCCCTGGGAATCTCTGG + Intergenic
1041583962 8:59494978-59495000 GTGCTGGCAGTGAGAATTTCAGG + Intergenic
1043433238 8:80214511-80214533 TTGCTGGCTCTGGGACTCTTTGG - Intronic
1044220390 8:89663185-89663207 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
1045847240 8:106652123-106652145 GTGCTGGCACTGGTGATCTTTGG + Intronic
1046752476 8:117940313-117940335 ATGCTGGCACAGGGAACCTGTGG + Intronic
1047196396 8:122725856-122725878 GTGCTATCACTGGGCATCTAGGG + Intergenic
1049249926 8:141582831-141582853 GAGCTGGCACTGTGAGGCTGAGG + Intergenic
1049256776 8:141618406-141618428 GAGTTGGCACTGGGAAGATGTGG - Intergenic
1050674476 9:8036601-8036623 GTGCTGGCACTGAGTGCCTGTGG + Intergenic
1050915176 9:11122399-11122421 GGGCTGGCACTGAGTGTCTGTGG + Intergenic
1050953596 9:11627646-11627668 GGGCTGGCATTGAGTATCTGTGG - Intergenic
1052986891 9:34494392-34494414 GTGCGGGTACTGGAACTCTGAGG + Intronic
1053415884 9:37946564-37946586 GGGCTGGCACTGGGGCCCTGTGG - Intronic
1053511096 9:38688236-38688258 TCGCTGGCACTGGGAGGCTGTGG + Intergenic
1055128241 9:72744172-72744194 GAAATGGCACTGGGAATGTGTGG - Intronic
1056020368 9:82432979-82433001 GTGCCTGCCCCGGGAATCTGGGG - Intergenic
1057071528 9:92104329-92104351 GTGCCTGCCCCGGGAATCTGGGG + Intronic
1057203212 9:93154700-93154722 GTGCAGGCACTGTGGAACTGGGG - Intergenic
1057346627 9:94257323-94257345 GAGATGGAACTGGGAATCTGAGG - Intergenic
1057898635 9:98930278-98930300 CTGCTGGCAGAGGGAATGTGCGG + Intergenic
1057915251 9:99050465-99050487 GTGCAGACACTGGGATGCTGAGG + Intronic
1057918576 9:99076735-99076757 ATGCTGGCAGTGGGAACTTGGGG + Intergenic
1059858399 9:118428113-118428135 GTGCTGACACTGTGAAGCCGTGG - Intergenic
1059925466 9:119205067-119205089 GTGCTAACACTGGGAACCTTGGG - Intronic
1061838278 9:133343175-133343197 ATGCTGGCTCTGGATATCTGTGG + Intronic
1185841418 X:3395114-3395136 GTGCTGCCCCAGGGACTCTGTGG + Intergenic
1186478868 X:9880404-9880426 GTGGTGGCACTGGCACGCTGTGG + Intronic
1187643361 X:21319062-21319084 GGGCTGGCATTGAGTATCTGCGG + Intergenic
1188243270 X:27813492-27813514 ATGCTGGTACTGGGAATGTCAGG + Intronic
1189408221 X:40744787-40744809 GGGCTGGCATTGAGTATCTGAGG + Intergenic
1191606856 X:63071879-63071901 GTGCTGGCGTTGAGTATCTGTGG + Intergenic
1191987696 X:67000444-67000466 GTGCTGGCATTGAGTTTCTGTGG + Intergenic
1192152389 X:68720296-68720318 GTGCTGTCCCCGGTAATCTGGGG - Exonic
1192459101 X:71302131-71302153 GTGATGGCAACAGGAATCTGTGG - Exonic
1193316491 X:80071584-80071606 GGGCTGGCATTGAGTATCTGTGG + Intergenic
1193571663 X:83151922-83151944 GTGCTGGCAGTGAGAATTTCAGG - Intergenic
1195328884 X:103780378-103780400 GTGCAAGCATTGGGAAGCTGAGG - Intronic
1196120143 X:112041165-112041187 GTGCTGGCAGTAGGAATTTGGGG + Intronic
1201354384 Y:13082349-13082371 GTCCTGCCACAGGGAATGTGGGG - Intergenic