ID: 904590617

View in Genome Browser
Species Human (GRCh38)
Location 1:31613437-31613459
Sequence GTTAGGACGTGGACATCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904590607_904590617 12 Left 904590607 1:31613402-31613424 CCTTTTGCCATGGAACATAGCCA No data
Right 904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG No data
904590606_904590617 13 Left 904590606 1:31613401-31613423 CCCTTTTGCCATGGAACATAGCC No data
Right 904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG No data
904590603_904590617 28 Left 904590603 1:31613386-31613408 CCACATCTGCAAAGCCCCTTTTG No data
Right 904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG No data
904590608_904590617 5 Left 904590608 1:31613409-31613431 CCATGGAACATAGCCACATGTTC No data
Right 904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG No data
904590614_904590617 -8 Left 904590614 1:31613422-31613444 CCACATGTTCTGGGGGTTAGGAC No data
Right 904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG No data
904590605_904590617 14 Left 904590605 1:31613400-31613422 CCCCTTTTGCCATGGAACATAGC No data
Right 904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904590617 Original CRISPR GTTAGGACGTGGACATCTTT GGG Intergenic
No off target data available for this crispr