ID: 904590850

View in Genome Browser
Species Human (GRCh38)
Location 1:31614650-31614672
Sequence CAGGATTAGATCAACAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904590841_904590850 29 Left 904590841 1:31614598-31614620 CCTAGGGTGACACTTGAAGATGG No data
Right 904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG No data
904590848_904590850 -6 Left 904590848 1:31614633-31614655 CCTGTGGCTCAGAGGCTCAGGAT No data
Right 904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904590850 Original CRISPR CAGGATTAGATCAACAAGGC TGG Intergenic
No off target data available for this crispr