ID: 904591453

View in Genome Browser
Species Human (GRCh38)
Location 1:31617744-31617766
Sequence GCCTAGGGAGGGGGCTGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 430}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904591443_904591453 -1 Left 904591443 1:31617722-31617744 CCCCGCGAGCCGAGGCAGCGCAG 0: 1
1: 0
2: 0
3: 2
4: 90
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430
904591441_904591453 16 Left 904591441 1:31617705-31617727 CCGCGGATCGTGCTGAGCCCCGC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430
904591448_904591453 -10 Left 904591448 1:31617731-31617753 CCGAGGCAGCGCAGCCTAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430
904591444_904591453 -2 Left 904591444 1:31617723-31617745 CCCGCGAGCCGAGGCAGCGCAGC 0: 1
1: 0
2: 1
3: 20
4: 182
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430
904591439_904591453 28 Left 904591439 1:31617693-31617715 CCCGCGCAGTTGCCGCGGATCGT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430
904591445_904591453 -3 Left 904591445 1:31617724-31617746 CCGCGAGCCGAGGCAGCGCAGCC 0: 1
1: 0
2: 1
3: 15
4: 137
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430
904591440_904591453 27 Left 904591440 1:31617694-31617716 CCGCGCAGTTGCCGCGGATCGTG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG 0: 1
1: 0
2: 2
3: 65
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904591453 Original CRISPR GCCTAGGGAGGGGGCTGCCC CGG Exonic
900372471 1:2338062-2338084 CCCCACAGAGGGGGCTGCCCCGG - Intronic
900396824 1:2456554-2456576 GCCGGGGGCGGGGGCTGCACAGG - Intronic
900458299 1:2787806-2787828 CCCTCCGGAGGGAGCTGCCCAGG - Intronic
900464556 1:2818946-2818968 GCCTAGGAATGGCGCTGTCCAGG - Intergenic
900611529 1:3546550-3546572 GGCTGGGAAGGGGGCTGCCAGGG + Intronic
900611564 1:3546643-3546665 GGCTGGGAAGGGGGCTGCCAGGG + Intronic
900611581 1:3546688-3546710 GGCTGGGAAGGGGGCTGCCAAGG + Intronic
900611616 1:3546784-3546806 GCCTGGGAAGGGGGCTGCCAGGG + Intronic
900648246 1:3718555-3718577 GCCTAGGGGAGGGGCTGCAGGGG + Intronic
900720393 1:4172190-4172212 TCCTGAGGAGGGAGCTGCCCTGG - Intergenic
900964067 1:5945296-5945318 GGGGAGGGATGGGGCTGCCCAGG - Intronic
901138058 1:7010282-7010304 GCCGAGTGAGGGGGCGGCCCAGG - Intronic
901203247 1:7478477-7478499 CCTTAGGGACTGGGCTGCCCAGG + Intronic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
901756545 1:11444768-11444790 GCCTGGGCAGAGGGCTGCCTGGG + Intergenic
902301831 1:15507403-15507425 GCCTGGGGAGAGGGCAGCCTTGG - Intronic
902372002 1:16013166-16013188 GTCTGGGGAGGGGGCTGCTGGGG + Intergenic
902690629 1:18108255-18108277 GCCGGGGGAGGGCGCTGGCCGGG + Intronic
902838463 1:19060836-19060858 GTCTTGGAGGGGGGCTGCCCAGG - Intergenic
903226142 1:21895101-21895123 GCCTAGGGTGAAGGCAGCCCTGG + Intronic
904236567 1:29121122-29121144 CCCCAGGGTGGGGGCAGCCCGGG + Exonic
904259533 1:29280381-29280403 GCCTGGAGAGGGGACTGTCCAGG + Intronic
904261346 1:29289554-29289576 GGCTGGGGAGGGGGCTGGCCAGG - Intronic
904295889 1:29519499-29519521 GGGTGGGCAGGGGGCTGCCCTGG + Intergenic
904336591 1:29802006-29802028 GGGCAGAGAGGGGGCTGCCCTGG + Intergenic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
904609723 1:31718825-31718847 ACATTGGGAGGGGGCTGTCCAGG - Intergenic
904619611 1:31767334-31767356 GTCGAGGAAGGGAGCTGCCCTGG + Intergenic
905794309 1:40807043-40807065 GCCCAGGGGTGGGGCAGCCCAGG + Intronic
906273658 1:44500720-44500742 CTCTGGGGAGGGGGATGCCCAGG - Intronic
906382131 1:45339681-45339703 GCCATCGGAGGAGGCTGCCCAGG - Exonic
906568775 1:46818858-46818880 GCCTGGGGAGGGTGGTGCCCAGG - Exonic
912174707 1:107141294-107141316 GCCTGGGGAGGAGGCTCCGCGGG + Intronic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
912795340 1:112689749-112689771 GCCTTGGGATGGGGCTTCCTGGG + Intronic
913532555 1:119743082-119743104 GGCTGGGGTGGGGTCTGCCCTGG + Intronic
914805482 1:150988181-150988203 GCCTAGGTAGGGGCCTGCTCAGG + Exonic
915334920 1:155135647-155135669 CCCTAGGAAGGGGACTGACCGGG + Intronic
915463034 1:156081144-156081166 GGCTGGGGAGGGGGCATCCCTGG - Intronic
917797613 1:178543037-178543059 GTGTGGGGAGGGGGCTTCCCAGG + Intronic
918185255 1:182121128-182121150 GTCTAGGGGAGGAGCTGCCCTGG + Intergenic
920065834 1:203268981-203269003 GCCTAGGGTAGTGGCTTCCCTGG + Intronic
920653099 1:207853199-207853221 GCCTAGGGAGGGTGGAGTCCCGG - Intergenic
920965779 1:210699501-210699523 GCCTAGGTAGGTGGATCCCCAGG + Intronic
922496576 1:226062416-226062438 GCCGGGGGCGGGGGCTGGCCGGG + Intronic
922748374 1:228059730-228059752 CCCTGGGGACGGGGCTCCCCTGG + Exonic
922795202 1:228336332-228336354 GGGCAGGGAGGAGGCTGCCCAGG + Intronic
923077719 1:230624801-230624823 GACTCAGGAGTGGGCTGCCCAGG - Intergenic
1062951261 10:1505649-1505671 GCATGGGGAGGTGGCTGCCATGG - Intronic
1062951276 10:1505698-1505720 GCATGGGGAGGCGGCTGCCACGG - Intronic
1062951292 10:1505747-1505769 GCATGGGGAGGCGGCTGCCATGG - Intronic
1063662794 10:8045494-8045516 CCCTCGGGAGCGAGCTGCCCAGG + Intergenic
1065001371 10:21340690-21340712 GCCTGGGGAGGGTGGTGCCACGG - Intergenic
1067077205 10:43194947-43194969 GCCTGGGGAGGAGGCAGCCCTGG - Exonic
1067565147 10:47331054-47331076 GCCTAGGGAGGGGAGAGTCCAGG - Intergenic
1068860650 10:61844706-61844728 GCCTGGGGTGGCGGCTTCCCTGG - Intergenic
1069604697 10:69731917-69731939 GCCTGTGGAGGGGGCGGGCCAGG - Intergenic
1069607953 10:69752050-69752072 GCCAAGGGATGGTGCGGCCCAGG - Intergenic
1070587766 10:77779764-77779786 CCCTGGGGAGGAAGCTGCCCTGG - Intergenic
1071722094 10:88157433-88157455 GCCTGGAAAGGGGGCTGACCAGG - Intergenic
1071831745 10:89378953-89378975 GCCTAGAGAGGAGACTGGCCCGG + Intronic
1072503455 10:96042341-96042363 GTCCAGGGAGAAGGCTGCCCTGG - Intergenic
1073053378 10:100683889-100683911 AGGGAGGGAGGGGGCTGCCCAGG - Intergenic
1073098797 10:100996623-100996645 CTCTAGGGAGGGGGCTGTGCTGG + Intronic
1073101387 10:101008515-101008537 GGCTGGGGAGGGGGCTGGGCTGG + Intronic
1073207153 10:101775429-101775451 GCCGAGGAAGGGGGCAGCCGCGG - Intronic
1073289636 10:102407164-102407186 GCATGGGGAAGGGGCTGCCTGGG - Intronic
1073489022 10:103840320-103840342 GTCTGGGGAGGGGGCTGGGCCGG - Intronic
1075563133 10:123482929-123482951 GGCTGGGGTGGGGGCTGCCGTGG - Intergenic
1075598442 10:123749277-123749299 CCTCAGGGAGGGGGCAGCCCAGG + Intronic
1075903543 10:126062372-126062394 TCCTAAGGAGGGGGCTTCCCTGG - Intronic
1076160794 10:128242930-128242952 GGCCAGGGAGGGAGCTTCCCTGG - Intergenic
1076556213 10:131322933-131322955 GCCAGGGCAGGAGGCTGCCCGGG + Intergenic
1076750859 10:132542237-132542259 GCAGAGGGACAGGGCTGCCCGGG - Intronic
1076792744 10:132785706-132785728 GCCTCCTGGGGGGGCTGCCCCGG - Exonic
1076821830 10:132943372-132943394 GCCTGGGGAGGGGAGGGCCCGGG + Intergenic
1077216889 11:1398715-1398737 CCCTGGGGAAAGGGCTGCCCTGG - Intronic
1077307857 11:1875942-1875964 CCCCAGGGAGGGGGCAGTCCAGG - Intronic
1077436167 11:2540195-2540217 GCCTGGGGAGGGGGCTGGGCAGG + Intronic
1077530613 11:3093085-3093107 GCCTAGGGGTCGGGCTGCCCGGG - Intronic
1081202681 11:40236737-40236759 GACTTGAGAGGGAGCTGCCCTGG + Intronic
1081488210 11:43547773-43547795 GACTGGGGAGGGGGCTTCCCCGG + Intergenic
1081699701 11:45145482-45145504 GCCTTGGGAGGAGGCTTCCCTGG + Intronic
1081866157 11:46361797-46361819 GCCTAGGGATGGTGGGGCCCGGG - Intronic
1082811781 11:57482897-57482919 GCTTGGGGAGGGGGCTGGGCAGG - Intergenic
1083184063 11:61007501-61007523 GCCTGGGCAGAGGGTTGCCCAGG - Intronic
1083343140 11:61971896-61971918 GCCCTGGGAGGCGGCTGTCCTGG - Intergenic
1083869229 11:65477004-65477026 GCCTGGGCAGGTGGCTGCCTTGG + Intergenic
1084091793 11:66883473-66883495 GCTGAGGGAGGTGGCTGCCCGGG - Intronic
1084156745 11:67317463-67317485 GCCGAGGGAGGGGGCTGTGACGG - Intergenic
1084209679 11:67615232-67615254 GCAGAGGGATGGGGCTGGCCTGG - Intergenic
1084418604 11:69049120-69049142 ACCTGGGGAGGGGACTGGCCCGG + Intronic
1085464845 11:76716458-76716480 GCCTCTGGAGGGGGCAGCCGTGG + Intergenic
1087118007 11:94544564-94544586 GCCGAGGCCGGGGGCTGCCATGG + Exonic
1087812709 11:102625239-102625261 AACTAGGGAGGGGGCTGCAGTGG + Exonic
1088988478 11:114929778-114929800 CCCTGGGGAGGAGACTGCCCTGG + Intergenic
1089617336 11:119702256-119702278 GCCGAGGGAGGTGGAGGCCCTGG - Intronic
1090264895 11:125347569-125347591 GCTGAGGGAGGTGGGTGCCCAGG + Intronic
1090521659 11:127486312-127486334 GCTGAGGGAGGGGACTGTCCAGG + Intergenic
1091294880 11:134466614-134466636 CACCATGGAGGGGGCTGCCCTGG + Intergenic
1091747718 12:3003379-3003401 GTCTAGGGGGTGGGCTGCCATGG + Intronic
1091822969 12:3490513-3490535 GCGTGGGCAGGGGGCTGCCAGGG + Intronic
1091832257 12:3558047-3558069 GCCTAGGGAGGAGGGAGACCAGG - Intronic
1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG + Intronic
1094004911 12:25738912-25738934 GCCTGGAGAGGAGGCTGCACTGG + Intergenic
1094192373 12:27710742-27710764 GCCTAGGGCGGTGCCAGCCCAGG + Intergenic
1094466014 12:30754694-30754716 GCGGAGGGAGGCGGCTGACCCGG - Intronic
1095559942 12:43552326-43552348 GAGAAGGGAGGGGGCTGCGCGGG - Intergenic
1096465860 12:51847634-51847656 GCCTGGGAAGGGGTCTGCGCGGG - Intergenic
1097240242 12:57570015-57570037 GGCTGGGGAGGAGGCAGCCCTGG + Exonic
1099776445 12:87137630-87137652 GCCTTGGGAGGGGTCTGTGCAGG + Intergenic
1100421252 12:94436003-94436025 CCCTAGGGATGGGGCTTCCTAGG - Intronic
1101421914 12:104557457-104557479 GCATTGGGAGGGGGATGCACCGG + Intronic
1101745413 12:107537939-107537961 GCCTATGGCTGGGGCTGCCTTGG + Intronic
1102009840 12:109611559-109611581 CCCGTGGGAGGGGGCTTCCCGGG - Intergenic
1102084481 12:110124642-110124664 GCCTCTAGCGGGGGCTGCCCTGG - Exonic
1103715861 12:122945007-122945029 GACTAGGGTGTGGGCTGCCATGG - Intronic
1103950994 12:124550895-124550917 GCCATGGGAAGGGGCTGCCGGGG - Intronic
1104734974 12:131131091-131131113 TCCTACTGAGGGAGCTGCCCAGG + Intronic
1104874110 12:132021216-132021238 GGCTGGGGCGGGGGCTGGCCTGG - Exonic
1104963276 12:132498125-132498147 GCCTGGGGAGGTGGCTGGCAGGG + Intronic
1105443070 13:20431294-20431316 GCGTAGGGAGGACGCTGCTCGGG - Intronic
1105529820 13:21209113-21209135 CCATGGGGATGGGGCTGCCCAGG + Intergenic
1105564471 13:21530738-21530760 GGCTGGGGTGGGGGCTGCTCTGG - Intronic
1106501534 13:30333809-30333831 CCCTTGGGAGGGGCCTGCTCTGG + Intergenic
1106776640 13:33016241-33016263 GCCGAGGGCGAGGGGTGCCCGGG - Intergenic
1107522992 13:41201709-41201731 ACCTAGTGAGGGGGCTGCCTTGG + Intergenic
1108408003 13:50124289-50124311 GCGTCGGGAGGGGGCGGCCGCGG + Intronic
1110136721 13:72076646-72076668 GCCCAGGTAGCAGGCTGCCCAGG - Intergenic
1113294812 13:108947348-108947370 GCCTAGGGAGGGTTCTGTACAGG - Intronic
1113613520 13:111664810-111664832 CTCTAGGGAAGGGTCTGCCCAGG - Intronic
1118728839 14:68652420-68652442 GGCTGGGGAGGGGGCCGTCCAGG - Intronic
1118868253 14:69719916-69719938 ACCCAGCGTGGGGGCTGCCCTGG + Intergenic
1119152530 14:72375447-72375469 GCCTAGGGACGTGTCTGCCAGGG - Intronic
1119156812 14:72419017-72419039 ACCCAGGGAGCGGGCTGCCTTGG + Intronic
1119198690 14:72736965-72736987 GCCCAGGGAGGCGGCTGGCTTGG - Intronic
1120765539 14:88323983-88324005 GCCTTGGGAGCGAGCTTCCCCGG - Intronic
1122050738 14:99058015-99058037 GCTTAGGGAGGGGAGTGCACAGG - Intergenic
1122077539 14:99245877-99245899 GCCAGGGAAGGGGGCTGGCCCGG + Intronic
1122120643 14:99551823-99551845 ACCTAGGGAGGGGGCTTGCTGGG - Intronic
1122134522 14:99625202-99625224 GCCTGGGGGCGGGGCTGCACAGG - Intergenic
1122786712 14:104167356-104167378 GCCTACGCAAGGGGCTTCCCTGG - Intronic
1122881920 14:104694066-104694088 GCCCAGGGAAGGGGCAGCCGGGG - Intronic
1122886602 14:104713125-104713147 GCTCAGGGAGGGGGACGCCCAGG + Intronic
1123059068 14:105586235-105586257 GGCTTGGGAGGGGACTCCCCTGG + Intergenic
1123083396 14:105706466-105706488 GGCTTGGGAGGGGACTCCCCTGG + Intergenic
1123931663 15:25174901-25174923 GTGTGGGGAGGGGGGTGCCCTGG + Intergenic
1123932528 15:25178712-25178734 GCATGGGGAGGAGGGTGCCCTGG + Intergenic
1123937131 15:25199422-25199444 GCATGGGGCGGGGGGTGCCCTGG + Intergenic
1123942271 15:25222321-25222343 GCATGGGGAGGGGGGTGCCCTGG + Intergenic
1124168640 15:27352633-27352655 GCCTTGGCAGGGGGCTTCCTTGG - Intronic
1125501093 15:40240720-40240742 GGCTAGGGACGGGGGTGCCAAGG + Intronic
1128067894 15:64775694-64775716 GGCGGGGGAGGGGGCTGGCCGGG - Intergenic
1128259279 15:66221246-66221268 TCCTTGGGAGAGGGCTGCCTGGG + Intronic
1128309768 15:66622539-66622561 GGCCAGGGAGGGGGCCGCCCTGG - Intronic
1128582658 15:68820086-68820108 GCGTGGGGAGGGGGCTGCAGCGG - Intronic
1129269434 15:74411628-74411650 GTCTATGGCGGGGGCTGCCACGG - Exonic
1129309421 15:74695823-74695845 GTCGTGGGAGGGGGCTGCCGGGG - Intronic
1129882610 15:79017042-79017064 GCTCAGGGAGGGGCCTGTCCTGG + Intronic
1130959003 15:88647440-88647462 GGCAGGGGAGGGAGCTGCCCTGG - Intronic
1132279689 15:100602424-100602446 GCAGAGGGTGGGGGCTGCCGGGG + Intronic
1132557195 16:577924-577946 GCAGAGGCTGGGGGCTGCCCGGG - Intronic
1133800929 16:9084722-9084744 GCCTAAGGATGGGGGTTCCCAGG + Intergenic
1134552768 16:15145652-15145674 GCCTAGGGGCCGGGGTGCCCAGG - Intergenic
1135163614 16:20118973-20118995 GCCTGAGGAGGGGGCTGGCATGG - Intergenic
1135636081 16:24076827-24076849 GCATAGGGTGGGGGCTGTGCCGG + Intronic
1136293134 16:29287724-29287746 GTCTCGGGTGGGGGCTGCCTCGG + Intergenic
1138275061 16:55728345-55728367 GCTTGGGGAGGGAGCTGCACAGG + Intergenic
1138280252 16:55767593-55767615 GCTTGGGGAGGGAGCTGCACAGG + Intergenic
1138288235 16:55826045-55826067 GCTTGGGGAGGGAGCTGCACAGG - Intronic
1138553471 16:57759375-57759397 GCACAGGGAGGGGGCTGCAGGGG + Intronic
1138584319 16:57960446-57960468 AGCTCGGGAGGGGGCTGCCTGGG - Intronic
1140279561 16:73542269-73542291 GCCTGGGGCGGGGGCTGCACAGG + Intergenic
1140731839 16:77863602-77863624 GGGCAGGGAGGGGGCTGCTCTGG + Intronic
1141460721 16:84177237-84177259 GCCTCGGGCGGGGGCAGGCCTGG + Intronic
1141522024 16:84586968-84586990 GCAGAGGGAGGGGGCTCGCCAGG - Intronic
1141590601 16:85066265-85066287 GAGAAGGGAGAGGGCTGCCCAGG + Intronic
1141997775 16:87646067-87646089 GCCCAGGCAGGAGGCTTCCCAGG + Intronic
1142099018 16:88261731-88261753 GTCTCGGGTGGGGGCTGCCTCGG + Intergenic
1142114661 16:88350383-88350405 GCCAAGGGAGGTGGGTGCGCCGG - Intergenic
1142177826 16:88652998-88653020 GCCTGGGGTGGGGGCTGCTGGGG - Intronic
1142712570 17:1731293-1731315 GCCCAGCGGAGGGGCTGCCCAGG + Intronic
1142863431 17:2776866-2776888 GCCGAGGGAGGGGGCGACCGCGG + Intergenic
1143367002 17:6414976-6414998 CCCCAGGGAAGGGTCTGCCCTGG - Intronic
1144021193 17:11241144-11241166 GGCGGGGGATGGGGCTGCCCAGG + Intergenic
1145242851 17:21249721-21249743 GGCTAAGGAAGGGGCTGCCCAGG + Intronic
1145909171 17:28532821-28532843 GGCTGGGGTGGGGGCTGCCCTGG + Intronic
1145976102 17:28985346-28985368 GCACAGGGTGGGGGCTTCCCTGG - Intronic
1147645981 17:42034179-42034201 GTCTGGGGAGGGGGCTGGGCAGG - Intronic
1148071355 17:44910669-44910691 GCAGAGGGAGAGGGCTGCCCGGG + Intronic
1148084953 17:44988226-44988248 GCCTGGGATGGGGGCTGCCCTGG - Intergenic
1148868586 17:50642334-50642356 TCCTAGGGAGGGCCCTGCCCAGG + Intronic
1149233686 17:54566207-54566229 TCCTAGGGAGGGGGCTGCTTTGG - Intergenic
1149774765 17:59348490-59348512 GCATGGGGTGGGGGCTGGCCAGG + Intronic
1151662419 17:75525795-75525817 GCCTCGGGCGGGGGCTGGCCCGG + Exonic
1151805039 17:76399962-76399984 GCCTAGGGCCAGGCCTGCCCAGG - Intronic
1151819624 17:76490526-76490548 GCATGGGGAGGGCACTGCCCTGG + Intronic
1152019891 17:77775521-77775543 CCCTAGGGAAGGGACTGTCCTGG - Intergenic
1152289348 17:79430001-79430023 GTCCAGGCAGGGGGCTGCCGAGG + Intronic
1152368147 17:79869341-79869363 CTCTAGGGAGGGGGCATCCCAGG - Intergenic
1152586667 17:81192428-81192450 GCCTGGCCAGGGGGCTGCACGGG - Intronic
1152639752 17:81444577-81444599 TCCAAGGGCGGGGGCTGGCCTGG + Intronic
1152758681 17:82097627-82097649 GCCCCGGGCGGGGGCTGCTCGGG + Intronic
1155096165 18:22558965-22558987 TCCTCGGGAAAGGGCTGCCCAGG - Intergenic
1157147010 18:45174101-45174123 GCCCAGGTCAGGGGCTGCCCTGG - Intergenic
1157475050 18:48018617-48018639 GCCTTGCTAGGGGGCTGCCCTGG - Intergenic
1158534199 18:58292499-58292521 GACTAGGGTGGGGGCAGCCCAGG - Intronic
1158536994 18:58317211-58317233 GCCACGGGAGGGGCCTGCCCAGG + Intronic
1159192762 18:65069468-65069490 ACCTAGGAAAGAGGCTGCCCTGG - Intergenic
1160412375 18:78683734-78683756 GCCCCTGGAGGGGGGTGCCCTGG - Intergenic
1160499662 18:79395640-79395662 GCCCGGGGAGGGGGGCGCCCGGG - Intergenic
1160682401 19:417844-417866 GCATAGGGGAGGGGCCGCCCAGG + Intronic
1160711701 19:554779-554801 GAAGAGGGAGAGGGCTGCCCCGG - Intergenic
1161007239 19:1942672-1942694 GATTAGGGAGGGGGCTGGGCGGG + Intronic
1161016721 19:1987051-1987073 GCCCAGGGTGGGGGCAGCACAGG + Intronic
1161090908 19:2359850-2359872 GCGCAGGGAGGGGTGTGCCCAGG - Intergenic
1161133942 19:2608641-2608663 GCAGAGAGAGGGGGTTGCCCGGG - Intronic
1161285888 19:3468200-3468222 CCTTGGGGAGGGGGCTGCCATGG - Intronic
1161457000 19:4374603-4374625 GGCCAGGGAGGAGGCTGTCCCGG - Intronic
1161575724 19:5053232-5053254 GCCTAGGGACAGGGCTGCATTGG + Intronic
1162423057 19:10577130-10577152 GAGTAGTGTGGGGGCTGCCCAGG - Intronic
1162751945 19:12834439-12834461 GCCTCGGGAGGGGGCTCCTGGGG - Intronic
1162806080 19:13138703-13138725 ACCAGGGGAGGGGGCTGGCCTGG + Exonic
1163241608 19:16067245-16067267 ACCTAGGGTGGGGGCTGCTCTGG - Intronic
1163272008 19:16260091-16260113 GCCTGGGGTGGGGGCCGGCCGGG - Intergenic
1163390338 19:17026820-17026842 GTCCGGGGAGGGGGCTGGCCCGG - Intergenic
1163423079 19:17226144-17226166 GCCTGGGGGCGGGGCTGACCTGG - Intergenic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1163687123 19:18717948-18717970 GCCCCGTGACGGGGCTGCCCAGG - Intronic
1164575849 19:29404888-29404910 GCCTGGGGAGGGGGCGGTGCCGG + Intergenic
1165093268 19:33397421-33397443 GACAAGGCAGGGGGCTGACCTGG + Intronic
1165120821 19:33557274-33557296 GCACAGGGAGGGGGCTGGCGTGG - Intergenic
1165935377 19:39385501-39385523 GCCTGGGGAGGGGGCTGGAGCGG - Intronic
1166140555 19:40803042-40803064 GCCCAGGGAGGGGCCGGCTCTGG - Intronic
1166231224 19:41426785-41426807 GCCCAGGGAAGGGGCGGCCGCGG + Exonic
1166393694 19:42424001-42424023 GCCTGGGGTGGGGGCGGGCCAGG + Intronic
1167089002 19:47330440-47330462 TCCCAAGGAGGGGGCTTCCCGGG + Intergenic
1167264675 19:48477756-48477778 ACGAGGGGAGGGGGCTGCCCTGG + Intronic
1167706577 19:51084580-51084602 GTCCAGGTACGGGGCTGCCCAGG - Intergenic
1167784729 19:51627652-51627674 GCACAGGGAGGGGGCCGGCCGGG + Exonic
925097771 2:1220851-1220873 GCCCGTGGAGGGGGCGGCCCAGG - Intronic
926207703 2:10845864-10845886 GCCGAGGGAGAGGGCTGACTGGG + Intergenic
926706485 2:15841296-15841318 GCCTATGGAGGGGACGTCCCGGG - Intergenic
926812690 2:16770593-16770615 GCCTGGGGAAGAGGCTGCTCAGG + Intergenic
927886307 2:26720920-26720942 GCCTAGCTAGGGGCTTGCCCAGG + Intronic
927982106 2:27380652-27380674 GCCAGGGCCGGGGGCTGCCCAGG - Exonic
928805115 2:35140827-35140849 GCCTAGGGACGGGGCATCCCTGG + Intergenic
930185750 2:48410741-48410763 ACCTGGGGAGGGCGCTGGCCTGG + Intergenic
932568603 2:72924808-72924830 GCCTCGGGAGCGGGCAGCGCAGG + Intronic
932892615 2:75609960-75609982 GCCTAGTGAGGGGGCTTCCTTGG + Intergenic
933634648 2:84694139-84694161 GCCCAGGGAGGAGGCTCCACTGG + Intronic
933808617 2:86018130-86018152 CCCCAGGGACAGGGCTGCCCGGG - Intergenic
934077619 2:88441327-88441349 GCCCAGGGAGGAGGCTGCCATGG + Intergenic
935062325 2:99619609-99619631 CCCTAAGGAGGGGCGTGCCCGGG + Intronic
936050827 2:109222619-109222641 GCCTAGGAAGGGTGGTGCCCTGG + Intronic
937155997 2:119719452-119719474 GCCAAGCGTGGGTGCTGCCCCGG + Intergenic
937298874 2:120826417-120826439 GCAGAGGGAGGGGGCTGGCTGGG - Intronic
937346165 2:121126948-121126970 GCCTCTTCAGGGGGCTGCCCTGG - Intergenic
937798893 2:126058781-126058803 CCCTAGGGATGGGGCTTCCTGGG + Intergenic
937863829 2:126733177-126733199 GCTTGGGGAGGGGGCTGCAGAGG + Intergenic
937908667 2:127064872-127064894 GCCCAGGGAAGGGGCTGTGCTGG + Intronic
941995744 2:171600607-171600629 GCCTATGGAGGAGGTGGCCCAGG + Intergenic
944383312 2:199136913-199136935 GCCTAAGGAGGGAGCAGACCTGG - Intergenic
944581511 2:201136955-201136977 CCCTGGGGAGGAGGCTGCCCTGG - Intronic
945974767 2:216261686-216261708 GCTTAGGGAGAGGTCTGGCCTGG + Intronic
946161660 2:217839427-217839449 CCCTGGGAAGGGGGCTGCTCTGG - Intronic
947640998 2:231707903-231707925 GCAGAGGGACGGGGCGGCCCAGG + Intronic
947752136 2:232538732-232538754 GCCCAGGGAGGGGGAAGCTCAGG + Intergenic
947938285 2:234026085-234026107 CCCTGGGGAGGGGGCTGCTAGGG - Intergenic
948385086 2:237576045-237576067 GCCAGGGGAGGGGCCTGCACAGG - Intronic
948675451 2:239594088-239594110 GCCTGGGGAGAGGACTGCCTGGG + Intergenic
948729108 2:239952238-239952260 GCGCAGGGAGGGGGCTGGCAGGG + Intronic
948888441 2:240895637-240895659 GCCCAGGGAAGGGGCTGGCCTGG - Exonic
1168972150 20:1938142-1938164 GCCTAGGGATGGGGGAGGCCAGG - Exonic
1169316167 20:4592653-4592675 GCCTTGGGGAGGGGGTGCCCCGG - Intergenic
1169414945 20:5408299-5408321 TCCTAGGGAGGCAGCTTCCCTGG + Intergenic
1171365127 20:24617944-24617966 GCCTGGGGAGGGGGAGACCCCGG + Intronic
1172511520 20:35504228-35504250 GCATCAGGAGGAGGCTGCCCGGG + Exonic
1172830152 20:37826991-37827013 GCACAGGGAGGGATCTGCCCAGG - Intronic
1173001666 20:39109794-39109816 AGCTGGGGAGGGGGCTGCCGGGG - Intergenic
1173225174 20:41158268-41158290 TCCTGGGGTGGGGGCTGGCCAGG + Intronic
1173386802 20:42595842-42595864 GCCTAGAGACAAGGCTGCCCAGG + Intronic
1174353690 20:49984674-49984696 GGCTAGGGAGGGGGCGGACCCGG - Intronic
1174368184 20:50068817-50068839 GCCAAGAGAGGGGGCTGCCAAGG + Intergenic
1175315727 20:58045307-58045329 GCCCTGGGAGGAGGCTGGCCTGG - Intergenic
1175402138 20:58706984-58707006 GCCTGGTGTGGGGGCTGCCCAGG + Intronic
1175491956 20:59385351-59385373 GCCCAGAGATGGGGCTGCTCAGG - Intergenic
1175545605 20:59775889-59775911 TGCTGGGGAGGGGGCTGTCCTGG + Intronic
1175806175 20:61830461-61830483 GCCTTGGGAGGTGGTGGCCCTGG - Intronic
1175823545 20:61924537-61924559 GGCGAGGGAGGGTGCTGGCCAGG + Intronic
1175847041 20:62064863-62064885 GGCGGGGGCGGGGGCTGCCCCGG + Exonic
1176214309 20:63941077-63941099 ACCTGGGGACGGGGCGGCCCCGG - Intronic
1176255946 20:64153059-64153081 ACAGGGGGAGGGGGCTGCCCAGG - Intronic
1178659868 21:34498420-34498442 CCCTAGGGATGGGGCTTCCTGGG + Intergenic
1178872182 21:36385738-36385760 GCCCGGGGAGGGGCCCGCCCCGG - Intronic
1179634991 21:42703177-42703199 GCCCAGGGAGGGGGTTGCTGCGG + Intronic
1180154906 21:45973013-45973035 CCCCAGGGAGGAGGCTTCCCGGG - Intergenic
1180162486 21:46004396-46004418 GCCTAGGGAAGGAGCTGCGCAGG - Exonic
1180175160 21:46083742-46083764 ACCACGGGAGGGAGCTGCCCAGG + Intergenic
1180183851 21:46129926-46129948 GCTGAGGGAGGGTGCTGCCCAGG + Intronic
1180184637 21:46133398-46133420 GACTAGAGAAGGGCCTGCCCCGG + Intergenic
1180597720 22:16989709-16989731 GCCCAGGGAGGGTGCAGCCTGGG + Intronic
1180786472 22:18550505-18550527 GCCTATGGTGGGAGCAGCCCAGG + Intergenic
1180862098 22:19089422-19089444 GCCAGGGGAGGGGGATGCACTGG + Exonic
1180976538 22:19851785-19851807 ATCAAGGTAGGGGGCTGCCCAGG + Exonic
1181033025 22:20157329-20157351 GCCTAGGGCAGGGGCTTGCCAGG + Intergenic
1181131753 22:20736228-20736250 GCCTATGGTGGGAGCAGCCCAGG + Intronic
1181243392 22:21490058-21490080 GCCTATGGTGGGAGCAGCCCAGG + Intergenic
1181441224 22:22936038-22936060 CCCCAGGGAGGGGGGTGGCCAGG + Intergenic
1181474053 22:23157879-23157901 GCCTGGTTGGGGGGCTGCCCTGG + Intronic
1181510282 22:23385908-23385930 GCCTAGGGCAGGGGCTGACCAGG - Intergenic
1181622147 22:24098415-24098437 GCCAGGGGAGGGGGCAGGCCAGG + Intronic
1181639496 22:24189233-24189255 GCCTGGGGAGGGAGCATCCCCGG - Intergenic
1182362142 22:29752952-29752974 GGTCAGGGAGGGGCCTGCCCAGG - Intronic
1182470393 22:30544616-30544638 GCCTAGGGATGGGGGAGGCCAGG - Intronic
1182511624 22:30824245-30824267 GCCTGGGGAGGAGGCGGCTCAGG + Intronic
1183538309 22:38415804-38415826 GCATAGGGGAGGGCCTGCCCTGG - Intergenic
1183653509 22:39172104-39172126 GCTCAGGGAGGGGGCTGCCCAGG - Intergenic
1183737065 22:39649991-39650013 GCAGATGGATGGGGCTGCCCAGG - Intronic
1184100286 22:42338412-42338434 GAGTCGGGAGGGGGGTGCCCAGG + Intronic
1184127819 22:42500422-42500444 GCCTAGGGGTGGGGCCGCCTAGG + Intergenic
1184191100 22:42895054-42895076 GCCTCTGGAGAAGGCTGCCCAGG - Intronic
1184330287 22:43822966-43822988 GACTAGGCTGAGGGCTGCCCAGG + Intergenic
1185056372 22:48580740-48580762 GTCTTGGCATGGGGCTGCCCCGG + Intronic
1185266517 22:49906955-49906977 GCCTGGGGAGGGCACTGCCTGGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950459681 3:13113706-13113728 GCCCACGCTGGGGGCTGCCCTGG - Intergenic
950831640 3:15880104-15880126 CCCTGGGGAGGAGGCTGCCCTGG + Intergenic
950864303 3:16176510-16176532 TCCTGGGGCTGGGGCTGCCCTGG - Intronic
950945343 3:16940122-16940144 GACGAGGGAGGGTGCTGCCTAGG - Intronic
951485334 3:23203400-23203422 GCCCTGGGAGAGAGCTGCCCAGG - Exonic
952964719 3:38614124-38614146 GCCAAGGGAGAGGGCTGGTCGGG - Intronic
953810604 3:46109331-46109353 GCCCAGGGAGGGGGATGGCCAGG - Intergenic
954134670 3:48576475-48576497 GCGTGGTGAGGGGGCTGACCAGG - Intronic
957438930 3:80216990-80217012 GGTTAGGGAGGAGGCGGCCCTGG + Intergenic
959941604 3:112086720-112086742 GGCTGGGGAGGGGACTGCTCGGG - Intronic
961041806 3:123683229-123683251 GCCCAGGGAGGGGGCTTCAAGGG - Intronic
961436275 3:126920442-126920464 GCCTAGGGATGTGGCTTTCCAGG + Intronic
961531707 3:127544177-127544199 GCCTGGGGTGGGGGCAGGCCAGG + Intergenic
962754375 3:138456981-138457003 GCAGAGGGAGGGGGGTGGCCAGG - Intronic
963830282 3:150000322-150000344 GCTTAGGGAGGAGGAAGCCCTGG + Intronic
966194308 3:177298114-177298136 GCCTGGGGAGAGAGCTGCCCAGG + Intergenic
967878196 3:194280990-194281012 CCCCAGGGAGGAGGCTGCCTTGG - Intergenic
967937358 3:194739600-194739622 GCCTGTGGAGGGGGCAGCACCGG + Intergenic
968090842 3:195897293-195897315 GTCTGGGGAGGAGGCTGGCCAGG + Intronic
968480274 4:830189-830211 GCCTGGCGGGTGGGCTGCCCGGG - Intergenic
968512835 4:1002983-1003005 GGCTCTGGAGGGGGCGGCCCGGG + Intronic
968520048 4:1031091-1031113 GACTGGGGAAGGGGCTGACCAGG - Intergenic
968606019 4:1536151-1536173 GCCCAGAGCGGGGGCTCCCCAGG + Intergenic
968658588 4:1789430-1789452 GCCTAGGGCTGGGGCTGCTGCGG - Intergenic
968966079 4:3769663-3769685 GCCTGGGGAGGGGTCAGCCCTGG + Intergenic
969303229 4:6309485-6309507 GCCCAGAGAGGGGGCTCCCACGG + Intergenic
969475911 4:7422381-7422403 GCCACGGGAGGGGCCTGCCCAGG - Intronic
970561373 4:17284962-17284984 GCCAAGGGACAGGGCTGCCTTGG + Intergenic
972099781 4:35400015-35400037 GGCTAGGGCTGGGGCTGCACTGG + Intergenic
976475259 4:85475625-85475647 GCCAGGGGAGGGGGCTGCGGGGG + Intronic
978954091 4:114594552-114594574 GCTTAGACAGGAGGCTGCCCTGG - Intergenic
980357435 4:131738331-131738353 GCCTAGGAAAGAGGCTGCTCCGG - Intergenic
981117657 4:141010786-141010808 ACCCAGGGAGGAGGCTGCCTGGG + Intronic
982346568 4:154366932-154366954 GCATGGGCAGGGGGGTGCCCTGG + Intronic
983894469 4:173067649-173067671 CCCTAGGGATGGGGCTTCCTGGG + Intergenic
984733483 4:183089437-183089459 GCCTACTGAGGGGGTTGGCCAGG + Intergenic
984964263 4:185127432-185127454 GCCTAGGCAGGGAGAAGCCCCGG + Intergenic
985498395 5:224587-224609 GAGGAGGCAGGGGGCTGCCCAGG - Intronic
985508849 5:300404-300426 GCCAAGGGAAAGGGCTGCCAGGG - Intronic
985521524 5:376060-376082 CACTAGGGAGGGGGCTGCGTGGG + Intronic
985573626 5:663700-663722 GCCAGGGCAGAGGGCTGCCCAGG - Exonic
985579646 5:689937-689959 GCCCTGGGTGGGGGCTGCCCTGG + Intronic
985594492 5:781996-782018 GCCCTGGGTGGGGGCTGCCCTGG + Intergenic
985739275 5:1605512-1605534 GCCAAGGGAAAGGGCTGCCAGGG + Intergenic
985759219 5:1736377-1736399 GCCCAGGGAGGGGCCTGGTCGGG - Intergenic
985790793 5:1926054-1926076 GCCTAGGGACTGAGCAGCCCTGG + Intergenic
986041709 5:4000089-4000111 GCCTAAGTAGGTTGCTGCCCTGG - Intergenic
986315315 5:6583081-6583103 GCCTAGGGCGGCGCCGGCCCGGG + Intergenic
986385378 5:7228042-7228064 CCCTGGGCAGGGGGCTGCCTTGG + Intergenic
988652303 5:33166300-33166322 CCCTAGGGATGGGGCTTCCTGGG + Intergenic
992612672 5:78520678-78520700 GCCAAGGGTGGGAGCTGGCCTGG + Intronic
998153549 5:139771264-139771286 GCCCAGGGGTGGGGCAGCCCCGG - Intergenic
999274414 5:150319400-150319422 GGCAGGGGAGGGGGCTGCCCAGG + Intronic
999299391 5:150481817-150481839 ACCCAGGGAGGTGGCTGCCGTGG - Intergenic
1000370907 5:160535714-160535736 ACCCAGGGTGGGGGCTGCCTGGG - Intergenic
1001241048 5:170070085-170070107 GTCTGAGGAGGGGGCTGCTCTGG - Intronic
1001334184 5:170783950-170783972 ACCGAGGGAGGGGGCAGGCCTGG + Intronic
1001486013 5:172120155-172120177 GCCAAGGGAGGTGGCTCCCCTGG - Intronic
1002101963 5:176862207-176862229 GGCGAGGGAGGGAGCAGCCCTGG - Intronic
1002161243 5:177315091-177315113 GCCCAGGGAGGAGGCTGGGCAGG - Intergenic
1002620128 5:180482216-180482238 GCCTAGGGCAGGGGTTCCCCAGG + Intergenic
1003889158 6:10548551-10548573 GGAGTGGGAGGGGGCTGCCCTGG - Intronic
1004302188 6:14468795-14468817 CCCTAGGGAGGTGGTTGCCAGGG - Intergenic
1005940471 6:30556266-30556288 CCCTGCGGCGGGGGCTGCCCCGG - Exonic
1006393521 6:33772570-33772592 GCCTCTGGAGTGGGCTGTCCTGG + Exonic
1006411480 6:33876519-33876541 GCATAGGGAAGGGTCTGCCAGGG - Intergenic
1006671397 6:35731826-35731848 GCGGAGCGACGGGGCTGCCCGGG - Intergenic
1006861041 6:37171500-37171522 GGCCCGGGAGGGAGCTGCCCAGG + Intronic
1007782687 6:44263492-44263514 GGCTGGGGAGGGGGCTGCTTGGG + Intronic
1009267180 6:61569846-61569868 CCCTAGGGATGGGACTTCCCAGG - Intergenic
1013184291 6:107744752-107744774 GCCTGGGGTGGGGACTGTCCAGG + Intronic
1013961830 6:115910287-115910309 GCCTGTGGAAGGGGCTGTCCTGG - Intergenic
1016820695 6:148343231-148343253 ACCTGGGGAGGGGGCGGCGCAGG + Intronic
1017811633 6:157988105-157988127 GCCCTGGGAGGGGGCTGAGCAGG - Intronic
1018798092 6:167202773-167202795 GCCCTGGAAGGGGGCTGGCCTGG + Intergenic
1018814620 6:167321403-167321425 GCCCTGGAAGGGGGCTGGCCTGG - Intergenic
1018905343 6:168072459-168072481 CCATAGGGAGGGGGATGCCCTGG + Intronic
1019016584 6:168884850-168884872 GCCAAGGGCCGGGGCTGCCTGGG + Intergenic
1019048045 6:169163018-169163040 GCCTGGGGCGGGGCCTACCCAGG - Intergenic
1019179027 6:170175793-170175815 GGCGGGGGCGGGGGCTGCCCGGG - Intergenic
1019267841 7:128783-128805 GCCTCGGGAGAGAGCTGACCCGG + Intergenic
1019289181 7:242028-242050 GCCCAGGGAGGGGCTGGCCCAGG - Intronic
1019412163 7:911429-911451 GCTTGGGGAGGGGGGTACCCTGG - Intronic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1019620168 7:1987951-1987973 GCCTAGGGAGGAGGCTGAGCTGG + Intronic
1020204793 7:6105576-6105598 GCCTGGGGAGGGGGCGCCCAAGG - Intronic
1020224840 7:6272271-6272293 GCCGAGGGAGGGGGCGGGCCGGG - Intronic
1020560512 7:9726041-9726063 GTCCGGGGAGGGGGCTGGCCCGG + Intergenic
1022103583 7:27183419-27183441 GCCTTGGGAAGGGGCAGCCCAGG - Intronic
1023454949 7:40328517-40328539 GCCTAAGGAGGGGGATAGCCTGG + Intronic
1024563442 7:50663218-50663240 CCCCAGGGAGGGGGCTGCCTGGG - Intronic
1025230954 7:57203142-57203164 GCCTCGGGAGGGGGCTCGGCAGG + Intergenic
1025664854 7:63576728-63576750 GCGTAGGGAGGAGGCTGTACAGG + Intergenic
1026941391 7:74289753-74289775 GCCGAGGGAGGGGGTCGCGCGGG + Intronic
1026980915 7:74526148-74526170 GCCTTGGGAGGGTTCTGCCCAGG + Intronic
1029212440 7:98919942-98919964 TCCTCAGGAGGGGGCAGCCCTGG - Intronic
1029640427 7:101816450-101816472 GACCGGGGAGGGGGCGGCCCCGG + Intronic
1030359367 7:108579408-108579430 GCAGAGGGAGGGGTCTTCCCAGG - Intergenic
1031998244 7:128246890-128246912 GCCTGTGGAGAGGGCAGCCCAGG + Intronic
1032075038 7:128832171-128832193 GGCTAGGGAGGGGACTGGACGGG - Intronic
1032095040 7:128933773-128933795 GCCTGTGGAGGAAGCTGCCCGGG - Intergenic
1032525663 7:132577003-132577025 GGCAAGGGTGGGGGCTGCCGCGG - Exonic
1033097393 7:138442761-138442783 CCCTGGGGAGGAGGCTTCCCTGG + Intergenic
1033369762 7:140697227-140697249 GCCTAGGGAGGGCGCGGTCCAGG + Intronic
1033619923 7:143052777-143052799 GGCTAGGAAAGGAGCTGCCCAGG - Exonic
1033654377 7:143362827-143362849 GGCCGGGGAGGGGGCGGCCCGGG + Intergenic
1034121363 7:148630997-148631019 ACCTTGGGAGGGGACTGGCCTGG + Intergenic
1034225072 7:149475304-149475326 GGCTGGGGAAGGAGCTGCCCTGG + Exonic
1034276556 7:149826378-149826400 TCCCAGGGAGGGAGCTGCCCTGG - Intergenic
1034448679 7:151126143-151126165 GCCTGGGGAGGGCGTTGCCGAGG + Intronic
1034552186 7:151828127-151828149 GCCTGGGGTCGGGGCTCCCCTGG - Intronic
1035288120 7:157819159-157819181 GCTTCCGAAGGGGGCTGCCCAGG - Intronic
1035319471 7:158019468-158019490 GGCCAGGGATGGGGCTGCACAGG + Intronic
1035414915 7:158674913-158674935 CCAGAGGGAGGGGGCTACCCAGG - Intronic
1035519682 8:266439-266461 ACCTGGGGAGGGGGCGGCCGGGG + Intergenic
1036616575 8:10392436-10392458 CCATAGGGAGAGGGCTGCACTGG - Intronic
1036707188 8:11054774-11054796 TCCGAGGGCGGGGGCTGCCAGGG + Intronic
1037883637 8:22585252-22585274 GCCCAGGGAGGATGCTGCCCCGG - Intronic
1038554149 8:28494633-28494655 GGCTAAGGGGGGAGCTGCCCCGG + Intronic
1039733017 8:40300130-40300152 CCCGAGGGAGGGGACTGCCAGGG - Intergenic
1039958226 8:42223489-42223511 GGCAAGGGAGGGCGCTGGCCTGG - Intergenic
1040385758 8:46914104-46914126 GACTGGGGAGGGGCCTGCCGGGG - Intergenic
1040834833 8:51720829-51720851 GCCTAGGCAGGAGCCTGCACAGG - Intronic
1043758293 8:84031686-84031708 GCTTAGAGATGGGGCTGCACTGG - Intergenic
1045063232 8:98425962-98425984 CCAAAGGGAGGGGGCTCCCCAGG + Intronic
1047369774 8:124246761-124246783 GCCTAGCAAGGCAGCTGCCCAGG + Intergenic
1048441215 8:134460381-134460403 GCCATGGCTGGGGGCTGCCCGGG + Intergenic
1049179075 8:141211503-141211525 GCCCAAGGACAGGGCTGCCCTGG + Exonic
1049478701 8:142809906-142809928 GCTGAGGGCAGGGGCTGCCCTGG + Intergenic
1049575822 8:143389157-143389179 GCCTTGAGAGGGGCCTGCCCAGG - Intergenic
1049795692 8:144496385-144496407 GCCCAGGGCAGGGGCTCCCCCGG + Intronic
1052941047 9:34132622-34132644 CCCTGGGGAGGAGGCTGCCCTGG - Intergenic
1053263299 9:36690341-36690363 GCCTTGGGAGCTGTCTGCCCCGG + Intergenic
1056312800 9:85358478-85358500 TCCTTGGGAGGGGCCTGCCATGG + Intergenic
1057263018 9:93596643-93596665 GCCTAGGGAGCTTGCTTCCCAGG + Intronic
1057412071 9:94825546-94825568 GCCTAGGGAGGGCGCTCCCCTGG - Intronic
1058670774 9:107359003-107359025 GCCCAAGGAAGGGGCTCCCCAGG + Intergenic
1059422461 9:114200802-114200824 GTCTGGGGTGTGGGCTGCCCGGG + Intronic
1059423299 9:114205931-114205953 CCCTAAGGAGGGGGCTTTCCAGG + Intronic
1059472755 9:114518975-114518997 GCCAAGGGAGGGGGGTTCCTGGG + Intergenic
1060527215 9:124327425-124327447 ACCTAGGGAGTGGGCTGCGGTGG - Exonic
1061085122 9:128393826-128393848 GCCTAGGGAGGGGGCTCCAGAGG - Intergenic
1061181370 9:129026967-129026989 TCCTGGGGAGGGGAGTGCCCGGG + Intronic
1061633357 9:131888429-131888451 GCTTAGGGAGCGCGCAGCCCCGG - Intronic
1061724738 9:132575902-132575924 GCCTAGGGAGGCAGCTGGTCTGG + Intergenic
1061913090 9:133735158-133735180 GGTTTGGGAGGGGCCTGCCCAGG - Intronic
1061926906 9:133810384-133810406 GCCTGGGTAGGGGGCTGCTATGG - Intronic
1062009422 9:134259117-134259139 CCCTGGGCAGGGGGCAGCCCTGG + Intergenic
1062042240 9:134409446-134409468 GCCTCGGGAGGAAGCTGGCCCGG - Intronic
1062082041 9:134629406-134629428 CCCTCGGGTGGGGGCTGCACGGG + Intergenic
1062216145 9:135390826-135390848 GCCAAAGGAGGGGGCAGCCATGG + Intergenic
1062235984 9:135507811-135507833 CCCTGGGGAATGGGCTGCCCGGG + Intergenic
1062272093 9:135714358-135714380 GGCTAGGGCGGGGGCTGCGCAGG - Intronic
1062279243 9:135744625-135744647 GTGTAGGGACGGGGCTGGCCAGG + Intronic
1062452843 9:136622772-136622794 GGCTAGGGAGAGCGGTGCCCGGG - Intergenic
1062554282 9:137107012-137107034 GCACGGGGAGGGAGCTGCCCTGG - Intronic
1062681149 9:137781956-137781978 GCCCAGTGAGGCGGCTGACCAGG - Intronic
1187565414 X:20444737-20444759 GTCTGGGGAGGGTGCTGGCCAGG + Intergenic
1187628408 X:21142089-21142111 GCCTAGGGACTGGCCTGCCTGGG - Intergenic
1189225113 X:39406482-39406504 GCCTGGAGAGAGGGTTGCCCCGG - Intergenic
1189320225 X:40083268-40083290 GTCGAGGGAGGTGGCTGGCCCGG + Intronic
1189658873 X:43277539-43277561 CCTTGGGGAGGAGGCTGCCCTGG - Intergenic
1189879942 X:45480240-45480262 GCCTAGGGAAGGGGCAACACTGG + Intergenic
1191640590 X:63427150-63427172 TCCTAGGAAGGGGGCAACCCAGG + Intergenic
1191972624 X:66833482-66833504 GCCTGGGGACTTGGCTGCCCTGG + Intergenic
1192170415 X:68851290-68851312 GCTTAGCGAGGGGGAAGCCCAGG + Intergenic
1192189768 X:68983712-68983734 GCACAGGGCTGGGGCTGCCCTGG - Intergenic
1195060748 X:101191625-101191647 GCCCGGGGAGGCCGCTGCCCGGG + Intergenic
1197526799 X:127574847-127574869 GCAGAGGCAGGGGGCTTCCCAGG - Intergenic
1198023765 X:132684651-132684673 TGCTAGGGAAGGGGCTGCCAAGG - Intronic
1200053461 X:153446538-153446560 ACCTAGGGATGGGGCAGCCTCGG + Intronic
1201147305 Y:11072357-11072379 GCCAAGGGAGTGGACTGCTCTGG + Intergenic