ID: 904591966

View in Genome Browser
Species Human (GRCh38)
Location 1:31619962-31619984
Sequence GGACATGTATAGTCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904591962_904591966 17 Left 904591962 1:31619922-31619944 CCTCCTGGTCACAGCCACAGACA 0: 1
1: 1
2: 3
3: 54
4: 341
Right 904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 71
904591963_904591966 14 Left 904591963 1:31619925-31619947 CCTGGTCACAGCCACAGACATAT 0: 1
1: 0
2: 1
3: 10
4: 192
Right 904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 71
904591961_904591966 18 Left 904591961 1:31619921-31619943 CCCTCCTGGTCACAGCCACAGAC 0: 1
1: 0
2: 6
3: 34
4: 376
Right 904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 71
904591964_904591966 3 Left 904591964 1:31619936-31619958 CCACAGACATATACATAGACACG 0: 1
1: 0
2: 3
3: 36
4: 363
Right 904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 71
904591960_904591966 19 Left 904591960 1:31619920-31619942 CCCCTCCTGGTCACAGCCACAGA 0: 1
1: 0
2: 2
3: 33
4: 273
Right 904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904591966 Original CRISPR GGACATGTATAGTCACCTCC AGG Intronic
900668144 1:3829910-3829932 GGACATGTACAGACAGCACCAGG - Exonic
901455159 1:9358900-9358922 GGACATGTGTCTGCACCTCCAGG - Intronic
902711870 1:18245992-18246014 GGGCATCTATCTTCACCTCCAGG - Intronic
904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG + Intronic
911070627 1:93829280-93829302 GTACAAGTATAGCCACCACCAGG - Intronic
913984398 1:143552011-143552033 GGAAAGGTATGGCCACCTCCTGG - Intergenic
920314970 1:205070508-205070530 GGACATGAATGGTATCCTCCTGG + Exonic
922484700 1:225964371-225964393 GGACATGTGCAGCCACCCCCAGG + Intergenic
923082459 1:230671560-230671582 GGTCATGTATAATAAACTCCTGG + Exonic
924619297 1:245646839-245646861 GCAAATGTTTAGTCACTTCCAGG + Intronic
1066143018 10:32526680-32526702 GGACATTTCTAATCACATCCTGG - Intronic
1066272712 10:33838894-33838916 CCACATGTAAATTCACCTCCGGG + Intergenic
1073335550 10:102705426-102705448 GGAGAAGTATTCTCACCTCCTGG + Exonic
1084067901 11:66715880-66715902 GGACCTGTACAGCGACCTCCGGG - Exonic
1085325041 11:75600161-75600183 TGACATGTTTAGTGTCCTCCAGG + Intronic
1086947728 11:92859855-92859877 TGACATCTATATTCACCTCAAGG + Intronic
1088030383 11:105241358-105241380 GGTCATGTATAGACACATTCAGG - Intergenic
1106849747 13:33777126-33777148 GGACAAGTATTGTCACCTCTTGG + Intergenic
1108273473 13:48785227-48785249 AGACATGTATAGACATCTCATGG - Intergenic
1112508177 13:99987939-99987961 GAACAGGTATTGTGACCTCCGGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1121504566 14:94466952-94466974 GAACATGTATAGACAGCCCCAGG + Intronic
1125289232 15:38127381-38127403 GGAGATGGATAGTCACCACTGGG - Intergenic
1126328091 15:47503964-47503986 GGACAGCTCCAGTCACCTCCTGG + Intronic
1128437726 15:67671608-67671630 GGACATGTAAAGTCACAACTTGG + Intronic
1131845432 15:96485838-96485860 GGACATGTTTATTCACTTTCAGG + Intergenic
1133709155 16:8384551-8384573 GGCCATGGAGATTCACCTCCTGG + Intergenic
1134378570 16:13702709-13702731 GGACATGTAGCCTCCCCTCCAGG + Intergenic
1136280127 16:29203494-29203516 GAACATGCAAAATCACCTCCAGG - Intergenic
1141069188 16:80937888-80937910 GGAGATGTAGGGTCTCCTCCTGG + Intergenic
1142615938 17:1135143-1135165 GGCTATTTATAGTCCCCTCCAGG - Intronic
1150708266 17:67507963-67507985 GGACATGTTTAAACACATCCTGG - Intronic
1153904224 18:9646779-9646801 AGCCATGTTCAGTCACCTCCTGG + Intergenic
1157572314 18:48721233-48721255 GCACATGTCTAGTTACCTGCAGG + Intronic
1159223995 18:65507561-65507583 GCACATTTATATTCACCTTCAGG + Intergenic
1165433804 19:35786321-35786343 GGACATGAAGAGGCGCCTCCTGG - Intronic
925125978 2:1456078-1456100 TGACATGTCTTGTCACCTCCCGG - Exonic
925886414 2:8397079-8397101 GGGCATGTATTGGCATCTCCTGG + Intergenic
931067739 2:58605509-58605531 GGAGGTGGATAGTGACCTCCAGG - Intergenic
936080324 2:109428557-109428579 GGACAAGTACAGCCTCCTCCAGG - Intronic
936795300 2:116196298-116196320 GGACATTTTTAGACACATCCTGG - Intergenic
941489402 2:166125208-166125230 GGTCCTGTATAGTCACCCTCAGG - Intronic
1168897656 20:1334855-1334877 GGACCAGTATAGTGACCCCCAGG + Intronic
1169015647 20:2290635-2290657 GGACACGTGTATTCACCTCCCGG + Intergenic
1172548759 20:35782577-35782599 GGACATGAAAAGTGACCTCTTGG - Intronic
1173016546 20:39230994-39231016 GGACAAGCATTCTCACCTCCTGG + Intergenic
1178537796 21:33424674-33424696 GGGCAAGTAGTGTCACCTCCTGG + Intronic
1180882752 22:19218101-19218123 GGATATCTGTAGCCACCTCCTGG - Intronic
1182473260 22:30561485-30561507 GGACAAGTTATGTCACCTCCTGG - Intronic
953362444 3:42309755-42309777 GGACATTTCTAGACACATCCTGG - Intergenic
954706546 3:52483776-52483798 GGTCATGTCTAGTCACCGTCTGG + Intronic
956564630 3:70622240-70622262 GGACATGTATATTCTCTTCAGGG - Intergenic
961515484 3:127430917-127430939 GGTCATGTCTAGTCACTTGCTGG - Intergenic
962368774 3:134803839-134803861 GGACAAGGATAGACAGCTCCTGG - Intronic
968464542 4:744036-744058 GGAAATGTTTAGGCTCCTCCGGG + Intronic
971186410 4:24381517-24381539 GGACATGTATTGTCATATCTTGG - Intergenic
971486039 4:27161288-27161310 GGTCATGTATAGTCAACTACTGG - Intergenic
977503602 4:97874228-97874250 GAACATGAATAGTCAACCCCAGG - Intronic
981024645 4:140065072-140065094 GGACATGTAAAGTCACTTGTGGG + Intronic
982181940 4:152756581-152756603 GGACATGTGCAGTCATCTCTTGG - Intronic
991510200 5:67367894-67367916 GCATTTGTATAGTCTCCTCCAGG + Intergenic
994963487 5:106636237-106636259 GGACATGGACATTCACTTCCAGG + Intergenic
995914804 5:117232129-117232151 GGACATATATTGTTACCTCTGGG - Intergenic
1000502830 5:162073969-162073991 GCACAAGTATAGTCACCCCCCGG + Intronic
1001051508 5:168418157-168418179 GGACAGGAATAGACACATCCAGG + Intronic
1001668216 5:173451189-173451211 GGAGTTGTATTGTCACCCCCTGG + Intergenic
1017077205 6:150630330-150630352 GGACTGGTACAGTCACCTCCTGG - Intronic
1018720560 6:166568744-166568766 GGACAAGCACAGTCACCTCCAGG - Intronic
1019515813 7:1439828-1439850 GGACCTGTAGTGCCACCTCCTGG - Intronic
1024235067 7:47391684-47391706 GGATTTGTATTGTCACCACCAGG - Intronic
1024242182 7:47444234-47444256 GGACACATATAGTCAGATCCTGG - Intronic
1024449828 7:49526599-49526621 GCACATTTATAGTCTCCTCAGGG - Intergenic
1035448097 7:158956714-158956736 GGGCACGTATAGTCCCCACCGGG - Intronic
1047486497 8:125335538-125335560 GGAAATTTTTAGTTACCTCCTGG - Intronic
1053177794 9:35941394-35941416 GGACATGTCTAGTCATCCCAGGG + Intergenic
1188210027 X:27411644-27411666 GGAAATGTATAGATGCCTCCTGG + Intergenic
1191920920 X:66256104-66256126 GGACATGTATAGTGGCCTGGTGG + Exonic
1195352875 X:104011332-104011354 GGACATGTAGGGTCACCTGGCGG + Exonic
1199860385 X:151796073-151796095 GGTCACTTATTGTCACCTCCAGG + Intergenic