ID: 904594584

View in Genome Browser
Species Human (GRCh38)
Location 1:31635368-31635390
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904594584_904594595 12 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594584_904594593 10 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594584_904594594 11 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594584_904594597 13 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904594584 Original CRISPR GGGCCTTATGGACCACCAGC TGG (reversed) Exonic
900122417 1:1054466-1054488 GGGCCTCATTGCCCACCTGCAGG - Exonic
900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG + Intronic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
912480719 1:109980524-109980546 GGCCCTTAGGGACCCCCAGAGGG - Intergenic
916746425 1:167688174-167688196 GGGTTTTATGGAGCATCAGCTGG + Intronic
919309998 1:195895096-195895118 GGGCATTCTGGATAACCAGCTGG + Intergenic
919860179 1:201734747-201734769 GGGCCTGATGGACCCTCACCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922539914 1:226410799-226410821 GGGCTTCATGGACCACCAAAGGG + Intergenic
1071782983 10:88867582-88867604 GGGCCTTATGGATCATCTTCTGG + Intergenic
1074377547 10:112951741-112951763 GGGCCTCCTGGGCCACGAGCGGG - Intronic
1074981954 10:118627006-118627028 GGGCCCCATTGACCTCCAGCTGG - Intergenic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG + Intronic
1088848160 11:113684683-113684705 GGGCCTTAATGAGGACCAGCTGG - Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG + Intergenic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1095291243 12:40482625-40482647 GGGACTACTGGACCAACAGCTGG + Exonic
1096067217 12:48750545-48750567 TGACCTTATGGACCACCATGGGG + Intergenic
1096111750 12:49033148-49033170 GGGCCTTATGGGACACAGGCTGG - Exonic
1098047044 12:66410846-66410868 GAACCTTATAGACCACCTGCAGG + Intronic
1100432802 12:94545826-94545848 GGGCCTTATAGGCCACAAGAAGG + Intergenic
1101983471 12:109427512-109427534 GGGGCTGATGGAGCACCTGCGGG + Exonic
1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG + Intergenic
1105636111 13:22216688-22216710 CGGCCTTAAGAACCACCAACAGG - Intergenic
1116500908 14:45619984-45620006 TGGCCTTATGGACGATCAGATGG + Intergenic
1121526586 14:94623604-94623626 CAGCCTTATGGACCACCTGTGGG - Exonic
1123203580 14:106691608-106691630 GGGCATTCAGAACCACCAGCAGG - Intergenic
1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123644375 15:22428405-22428427 CGGCTTTATGGACCACCTGGAGG - Intergenic
1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG + Intergenic
1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG + Exonic
1124298260 15:28523344-28523366 CGGCTTTATGGACCACCTGGAGG - Exonic
1124959177 15:34382227-34382249 CGGCCTTATGGACCTCCTGGAGG - Exonic
1124975803 15:34528448-34528470 CGGCCTTATGGACCTCCTGGAGG - Exonic
1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG + Intergenic
1132432402 15:101772458-101772480 TGGCCTTATGGACCTCCTGGAGG - Intergenic
1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG + Exonic
1139289705 16:65846318-65846340 GGGCATTTTGGGCCACCATCCGG - Intergenic
1140898708 16:79348904-79348926 GGGCCTTGAGGTCAACCAGCTGG - Intergenic
1142578184 17:923132-923154 TTGCCTTAGGGACCACCACCTGG + Intronic
1144242248 17:13323987-13324009 GGGTCTTCTGGAAAACCAGCAGG + Intergenic
1146184749 17:30717499-30717521 GGGCCTTGTGGACCTCAAGGAGG - Intergenic
1147220189 17:38924112-38924134 GGGCCTTCCGGACCAACAGGGGG + Intergenic
1148842715 17:50508983-50509005 GGGCCTCAGGGACCACTGGCTGG + Intronic
1148896102 17:50840098-50840120 GGGCGTTATAGATGACCAGCTGG - Exonic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1150096569 17:62381452-62381474 AGGGCTTATGGACCAGAAGCTGG - Intronic
1156588445 18:38459168-38459190 GGGCTTAATGAAACACCAGCTGG + Intergenic
1161621410 19:5299214-5299236 GGGCCTTGTGGGCCACCAGGAGG - Intronic
1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG + Intergenic
1166836071 19:45668861-45668883 GGGCTTTATCTACCCCCAGCGGG + Intronic
926523050 2:13941851-13941873 AGGCCTGATGGTCCACCAGATGG - Intergenic
926650749 2:15341629-15341651 GGGCCTTATGAAGAAACAGCGGG + Intronic
929968072 2:46550457-46550479 GGGCCTTAGTGATCACCAGTGGG + Intronic
931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG + Intergenic
935113202 2:100110664-100110686 GGGACTTGGGGACCCCCAGCAGG - Intronic
936955836 2:118021263-118021285 GGACCTTGGGGACCACCAGGAGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946509154 2:220335444-220335466 GGACCTAATGAAACACCAGCTGG - Intergenic
947753058 2:232542769-232542791 GTGCCCTAAGGAGCACCAGCAGG - Intronic
1172727760 20:37059495-37059517 AGTCCGTATGTACCACCAGCAGG - Intronic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1177791471 21:25726686-25726708 TAGCATTATGGACCAGCAGCAGG + Intronic
1179258453 21:39737881-39737903 GGGCCTTATGACCCACAAACAGG + Intergenic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG + Intronic
949829791 3:8201609-8201631 GGGCCTTATGGACCCACTTCAGG + Intergenic
950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG + Intronic
950416647 3:12872746-12872768 GGGCCTTCTGGACCTTCATCAGG - Intergenic
950787786 3:15450328-15450350 GGGCCTGGTGGACCATCACCTGG - Exonic
958158566 3:89787352-89787374 GGTCCTTATTGACTACCAGGTGG + Intergenic
961002259 3:123381965-123381987 GGGCCTTGCCCACCACCAGCTGG - Intronic
967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG + Intronic
968675826 4:1878775-1878797 GAGCCTTATGCACCATTAGCAGG + Intronic
979872465 4:125841161-125841183 GGGCCTTATGAACCACTTTCAGG + Intergenic
982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG + Intergenic
986275572 5:6272224-6272246 GGGCCTGCAGGATCACCAGCTGG - Intergenic
986433941 5:7709521-7709543 GGCCCTTATGAACAACCATCAGG + Intronic
991284658 5:64958971-64958993 GAGGCTTATTGACCACCAGATGG + Intronic
1001243364 5:170087013-170087035 AGGCCTTATGGACAAGCAACTGG + Intergenic
1004266679 6:14154119-14154141 GGGCCTGATGGACAATAAGCAGG - Intergenic
1005831233 6:29672730-29672752 GGGCCTTATGGATCACTGGAGGG - Exonic
1012976384 6:105784919-105784941 GGACTTCATGGGCCACCAGCAGG - Intergenic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG + Intergenic
1026362450 7:69615161-69615183 GGGTATTATAGACCACCAGAGGG - Intronic
1052063348 9:23987299-23987321 GGGCCTTAAGGAACATCAGAGGG + Intergenic
1058608825 9:106753001-106753023 GGGTCTTATGGCCCCCCATCTGG - Intergenic
1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG + Exonic
1187366467 X:18669714-18669736 GGGCCTTATGCATCTCCATCTGG + Intronic
1192174388 X:68876790-68876812 GGGCCTTGTGGAGCTACAGCAGG - Intergenic
1195850343 X:109275990-109276012 GGGTCCTAAGGAACACCAGCTGG + Intergenic