ID: 904594593

View in Genome Browser
Species Human (GRCh38)
Location 1:31635401-31635423
Sequence GGACCCCCATAACCACCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 155}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904594588_904594593 -2 Left 904594588 1:31635380-31635402 CCATAAGGCCCTCCAGGGGCAGG 0: 2
1: 0
2: 1
3: 21
4: 220
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594590_904594593 -10 Left 904594590 1:31635388-31635410 CCCTCCAGGGGCAGGACCCCCAT 0: 2
1: 0
2: 0
3: 23
4: 195
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594580_904594593 17 Left 904594580 1:31635361-31635383 CCCTCCACCAGCTGGTGGTCCAT 0: 1
1: 1
2: 1
3: 16
4: 181
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594581_904594593 16 Left 904594581 1:31635362-31635384 CCTCCACCAGCTGGTGGTCCATA 0: 1
1: 1
2: 0
3: 14
4: 132
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594582_904594593 13 Left 904594582 1:31635365-31635387 CCACCAGCTGGTGGTCCATAAGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594584_904594593 10 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155
904594577_904594593 25 Left 904594577 1:31635353-31635375 CCATAGGGCCCTCCACCAGCTGG 0: 1
1: 1
2: 2
3: 17
4: 167
Right 904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG 0: 1
1: 1
2: 2
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904594593 Original CRISPR GGACCCCCATAACCACCACC AGG Exonic
900114074 1:1021085-1021107 GTACCCCCAAAACCATCTCCTGG + Intronic
901868882 1:12125973-12125995 CGACCACCACAACCAACACCAGG - Exonic
904432953 1:30476944-30476966 GGACCCCCAGAACCACTTGCGGG - Intergenic
904594593 1:31635401-31635423 GGACCCCCATAACCACCACCAGG + Exonic
905999294 1:42410102-42410124 GGCCCCCTACCACCACCACCCGG - Exonic
910147248 1:84096207-84096229 GGGCCCTGATAAACACCACCAGG - Intronic
911945879 1:104108273-104108295 CCACCCCCATGACCTCCACCTGG - Intergenic
912412818 1:109489970-109489992 GGGTCCCCATCACCACCACAGGG - Exonic
913996505 1:143655037-143655059 GGACCTCCAGTACCACCAACTGG - Intergenic
915900000 1:159840045-159840067 GGACCACCCTAACCACCACCAGG - Intronic
916674797 1:167055968-167055990 GGAGCCCCATGTCCACCTCCAGG + Intronic
920238943 1:204529548-204529570 GGACCCCCATAGCCACCACCAGG + Intronic
920535586 1:206734565-206734587 TGACCTACATAGCCACCACCAGG + Intergenic
1067295178 10:44971564-44971586 CGACCCCCATGCCCCCCACCAGG + Intronic
1068013740 10:51487515-51487537 GGCCCCCCAGAAGCCCCACCTGG + Intronic
1069522694 10:69137317-69137339 GGACCCAGCTAACCTCCACCTGG - Intronic
1073637984 10:105219103-105219125 GTATCCCCAAGACCACCACCAGG + Intronic
1073710596 10:106033600-106033622 GAACCCCCATAATAAACACCAGG + Intergenic
1074038103 10:109761419-109761441 GGCCCACTATAACCACTACCTGG + Intergenic
1074563795 10:114558213-114558235 GCCCCCCCATATCCACGACCAGG + Intronic
1077239333 11:1502460-1502482 GGGCCCCCATGACTCCCACCAGG + Intergenic
1078578014 11:12517627-12517649 GGAGCCCCATGAGCAGCACCAGG - Exonic
1083164277 11:60873940-60873962 GGTAACCCATAACCACCACCAGG + Intronic
1083896774 11:65624061-65624083 CCACCCCCATCACCCCCACCTGG + Intronic
1084566084 11:69929952-69929974 GCACCCCCAGAACTACCAGCTGG - Intergenic
1087091971 11:94282922-94282944 TCTCCCCCATAAACACCACCAGG + Intergenic
1087313285 11:96576626-96576648 GGACCACTGTAACCACTACCTGG + Intergenic
1088459264 11:110065318-110065340 CCACCCCCACAACCACCTCCTGG + Intergenic
1090515587 11:127423375-127423397 AAACCCACATAACCACTACCTGG + Intergenic
1090607887 11:128442251-128442273 GGAAACCCATAACCACTACAAGG - Intergenic
1091257850 11:134206477-134206499 TCACCCCCAAAACCACCATCAGG + Intronic
1092295684 12:7198324-7198346 ACACTCACATAACCACCACCCGG - Intronic
1092523742 12:9297117-9297139 GGAACCCCATGACCATCTCCTGG - Intergenic
1092543555 12:9434782-9434804 GGAACCCCATGACCATCTCCTGG + Intergenic
1094509388 12:31087269-31087291 GGAACCCCATGACCATCTCCTGG - Intronic
1099657348 12:85510009-85510031 GACCGCCCATAACCACCACGAGG - Intergenic
1100141369 12:91622894-91622916 GGATCCCCAAGACCACCCCCTGG + Intergenic
1103481267 12:121251312-121251334 ACACCCACATACCCACCACCTGG - Intronic
1103836894 12:123828967-123828989 GGACCCTCTAATCCACCACCAGG + Intronic
1104198155 12:126561340-126561362 AGACCCACACATCCACCACCCGG + Intergenic
1104605315 12:130183767-130183789 GACCCCCCACAACCACCATCTGG + Intergenic
1104693932 12:130849075-130849097 GGACCCCAACCAACACCACCTGG + Intergenic
1106349889 13:28920535-28920557 GGCCCACTATAACCACTACCTGG + Intronic
1114182939 14:20380864-20380886 GGGCCCCCATAAGCACACCCAGG + Intronic
1119177391 14:72579232-72579254 GGTCTTCCATGACCACCACCTGG + Intergenic
1120697546 14:87660323-87660345 GGACCTCTGTAACCACTACCTGG - Intergenic
1121762274 14:96455854-96455876 CTACCCCCACCACCACCACCAGG - Intronic
1124081284 15:26500782-26500804 GGCCCCCTATAACCACTCCCTGG + Intergenic
1124176081 15:27425301-27425323 GGATCCCCAAAACCATCCCCAGG - Intronic
1124724660 15:32145629-32145651 GGACACCCCTCCCCACCACCAGG + Intronic
1128862457 15:71085404-71085426 GGGTCCCCAAGACCACCACCAGG - Intergenic
1129828255 15:78649945-78649967 GAACCCACATAACAAACACCTGG - Intronic
1138064314 16:53924771-53924793 GCACCCCCAAAACCTCCTCCGGG + Intronic
1138356331 16:56383891-56383913 AGACCCCCACCACCACCACCAGG - Intronic
1139595002 16:67952290-67952312 TGACCCCCACAAACACCACCAGG + Exonic
1142987668 17:3706567-3706589 GCTCCCACATCACCACCACCTGG + Intergenic
1144050992 17:11497067-11497089 GGACCCCCAGAACCATGTCCTGG + Intronic
1144492390 17:15724923-15724945 GGATCCCCAAGACCACCCCCAGG + Intergenic
1146677364 17:34782678-34782700 CAGCCCCCAGAACCACCACCTGG + Intergenic
1149430764 17:56594262-56594284 GCAGCCCCAGGACCACCACCAGG - Exonic
1149487194 17:57051747-57051769 ACACCCATATAACCACCACCAGG - Intergenic
1151054198 17:71012867-71012889 AGACCCCCATGGCCTCCACCAGG - Intergenic
1151576658 17:74955843-74955865 TGCCGCCCAGAACCACCACCTGG - Exonic
1156384468 18:36593229-36593251 GGACTTCCATCACCACCACTGGG - Intronic
1160521985 18:79513135-79513157 CGATACCCAGAACCACCACCAGG + Intronic
1161008962 19:1950856-1950878 GATACCCCATAACCCCCACCTGG - Intronic
1161579956 19:5075267-5075289 GGGCCCCCGGAACCAACACCAGG - Intronic
1162007006 19:7787538-7787560 GCACCGCCATAGACACCACCAGG + Intergenic
1162022648 19:7874672-7874694 CGACCCCCACCACAACCACCTGG + Intergenic
1166199988 19:41231193-41231215 GCAGCCCCGTAACCTCCACCTGG + Exonic
1166739149 19:45103707-45103729 TCACCTCCATCACCACCACCAGG - Intronic
1167271463 19:48508909-48508931 GGAGCTCCTTCACCACCACCTGG + Exonic
927149628 2:20188216-20188238 GGAGCCCCATGACTACCTCCAGG + Intergenic
927757285 2:25719142-25719164 GCACCCCCACAACCCACACCAGG - Intergenic
928082960 2:28326476-28326498 AGCCCCCCACACCCACCACCTGG + Intronic
929931072 2:46255952-46255974 CCACCCCCATAACCACCACTCGG + Intergenic
931393177 2:61862283-61862305 GGACCCCCCCCACCACCATCAGG - Intergenic
931600753 2:64000856-64000878 GGCCCACCGTAACCACTACCTGG + Intronic
931855609 2:66299147-66299169 TGGCCCTCATACCCACCACCTGG - Intergenic
932855623 2:75231250-75231272 AGACTCACATAACCACCACATGG - Intergenic
935828822 2:106978095-106978117 GCACCCCCATTATCACCAGCTGG - Intergenic
939404972 2:141745170-141745192 GGCCCACTATAACCACTACCTGG + Intronic
945055841 2:205868377-205868399 TACCCCCCACAACCACCACCCGG + Intergenic
946611730 2:221465757-221465779 CAACCCCCATCACCACCAACTGG + Intronic
947498511 2:230656212-230656234 GCAACCCCATACACACCACCTGG + Intergenic
948909127 2:240994242-240994264 GGACCCCCAGAACCACCTCATGG + Intergenic
1171311806 20:24150797-24150819 GAAACCCCAAAACCACCGCCAGG + Intergenic
1174588963 20:51630133-51630155 GGACGCCCCCAACCACCACCAGG + Intronic
1175923635 20:62461660-62461682 CGACCCCCACAAACACCTCCAGG + Intergenic
1176119351 20:63447017-63447039 GCACCCCCATAGCCACCTCCCGG + Intronic
1180636042 22:17263881-17263903 GGACCCCCAGAACCACTGGCTGG + Intergenic
1180723276 22:17925272-17925294 GCTCCCCAAAAACCACCACCAGG + Intronic
1181166650 22:20987528-20987550 GGCCCCCCGTTACCACCACTCGG + Exonic
1183642593 22:39101479-39101501 GGAAGCCCATGACCTCCACCGGG - Exonic
950718776 3:14867910-14867932 GCACCCCCAAAAACACCTCCCGG - Intronic
953459559 3:43071748-43071770 AGACAGCCATAAGCACCACCTGG + Intergenic
954415506 3:50391366-50391388 GTGCCACCAAAACCACCACCAGG - Intronic
955320937 3:57973782-57973804 GGACCACCAGCAGCACCACCAGG - Intergenic
961660651 3:128467184-128467206 CCACCACCATCACCACCACCGGG - Intronic
962360601 3:134739770-134739792 CCACCCCTATAACCACAACCTGG - Intronic
962630351 3:137269549-137269571 CCACCCCCATCACCACCACCAGG - Intergenic
964757817 3:160104676-160104698 GGACCCCCCCAACCACCAGGTGG - Intergenic
968511021 4:996037-996059 ATACCCCCATAGCCTCCACCTGG + Intronic
968864853 4:3202023-3202045 GGACCCACATAAGGACCTCCTGG - Intronic
969855437 4:9995359-9995381 AGACCCTCATAAGCACCACTTGG + Intronic
970333168 4:15004314-15004336 GAACTCCTATAACCACCACCAGG + Exonic
971265123 4:25090262-25090284 GGACCCACAAAGCCACCCCCTGG - Intergenic
977961592 4:103091151-103091173 AGACCACCACCACCACCACCAGG - Intronic
978446780 4:108787783-108787805 AGACCCCCAACACCCCCACCAGG + Intergenic
979573087 4:122252817-122252839 GGCCCCCTGTAACCACTACCTGG - Intronic
983519343 4:168690632-168690654 GGCACTCCAGAACCACCACCTGG - Exonic
985979624 5:3451696-3451718 GAACCCCCATGTCCACCACAAGG - Intergenic
988039761 5:25874269-25874291 GGCCCCCTATAACTACTACCTGG + Intergenic
991903793 5:71487669-71487691 GGGTCCCCACGACCACCACCGGG + Intronic
992501823 5:77350862-77350884 AGATCCACATATCCACCACCAGG - Intronic
993091020 5:83426678-83426700 GGTGCCCCAAAACTACCACCAGG + Intergenic
993138403 5:83998873-83998895 GCACTCCCATAACCACCACTGGG - Intronic
993226352 5:85170027-85170049 GGACCCCCATACATACCCCCAGG - Intergenic
995582143 5:113613420-113613442 GGGCTCCCCTAACCACCACCAGG - Intergenic
996453515 5:123655072-123655094 GGCCCCCCATGAGCATCACCGGG - Intergenic
997071908 5:130632797-130632819 GGCCCCCTGTAACCACTACCTGG + Intergenic
1002040199 5:176507849-176507871 CAGACCCCATAACCACCACCTGG - Exonic
1002588661 5:180271297-180271319 TGACCGCAATAACCACAACCAGG - Intronic
1004651344 6:17612747-17612769 GGACCCCCATCACCAGAAACTGG - Intergenic
1005709473 6:28489824-28489846 GGACCCCCCCCCCCACCACCGGG - Intergenic
1006389302 6:33749088-33749110 GGAATCCCAGAACCACCACAGGG + Intergenic
1007479689 6:42142073-42142095 GGACCCCCCCCACCACCACGGGG - Intronic
1007601744 6:43086347-43086369 GGGCCCCCATAACCACCCCCAGG - Intronic
1007738357 6:43995826-43995848 ATGCCCACATAACCACCACCCGG + Intergenic
1011322753 6:86115419-86115441 GGCCCACTGTAACCACCACCTGG + Intergenic
1011385383 6:86791863-86791885 CTACCCCCATCACCATCACCAGG + Intergenic
1011562535 6:88636058-88636080 GAACCTCCCTTACCACCACCTGG + Intronic
1011871526 6:91900345-91900367 GGACCAGCAAAACCACAACCTGG + Intergenic
1011891991 6:92175192-92175214 GGGCCCCCCCCACCACCACCAGG - Intergenic
1013594684 6:111649890-111649912 CCACCCCCATGCCCACCACCAGG - Intergenic
1014928485 6:127304059-127304081 GGCCTTCCATAACCACCCCCTGG - Intronic
1015578716 6:134701202-134701224 GGCCCACAATAACCACCACCTGG + Intergenic
1018015868 6:159712047-159712069 CCACCTCCATAACCACCACTCGG + Intronic
1018704058 6:166450299-166450321 GGACCACCATAGGGACCACCAGG + Intronic
1018893144 6:167996637-167996659 TGACGCCCACACCCACCACCAGG - Intronic
1019322696 7:422833-422855 GGACCCCTGGAACCAACACCCGG - Intergenic
1019699463 7:2467384-2467406 GCACCCACATACCCACCCCCTGG - Intergenic
1022307543 7:29161531-29161553 GGACCACAATAACCAGGACCAGG - Intronic
1022529627 7:31058721-31058743 GGACCCCCACACACACCTCCAGG - Intronic
1024399119 7:48903692-48903714 GGACCACCATAACCATCAATGGG - Intergenic
1030598980 7:111571239-111571261 GGCCTCCTATAACCACCCCCTGG - Intergenic
1031883669 7:127223545-127223567 GGAGCCCCAACACCTCCACCAGG + Intronic
1034278246 7:149833719-149833741 GGACGCCCAGAGCCAACACCAGG - Intergenic
1034895339 7:154872719-154872741 GGAGCCCCAGAACGAGCACCAGG - Intronic
1036059238 8:5296220-5296242 GGACCCCAATAAGCAGCAGCTGG + Intergenic
1037503277 8:19505774-19505796 GCACCAGCAAAACCACCACCCGG + Exonic
1038519591 8:28218849-28218871 GGAACCCGATCACCACCAACTGG + Intergenic
1039741328 8:40385611-40385633 AGACTCCCATGACCACCAGCTGG + Intergenic
1041500306 8:58532984-58533006 GGCCTGCCATAACCACTACCTGG + Intergenic
1042689543 8:71482935-71482957 ACACCCCTGTAACCACCACCAGG - Intronic
1043916996 8:85934313-85934335 GGCCCCCAATAATCCCCACCTGG - Intergenic
1044966491 8:97579069-97579091 GGACTCCCACACCCAGCACCAGG + Intergenic
1045650793 8:104340128-104340150 GGCTCCCCATAACCACCAGGAGG - Intronic
1046150071 8:110211974-110211996 TGCCCACCATAACCACTACCTGG - Intergenic
1048806296 8:138244471-138244493 GGACCCCAACAACCACCAAATGG - Intronic
1056653326 9:88488057-88488079 GGTGCCCCTTAACCACAACCTGG - Intergenic
1057278535 9:93692463-93692485 GGACCCAAATCACCAACACCAGG + Intergenic
1059365976 9:113786677-113786699 GGACCCCTATAAGCCCCTCCAGG + Intergenic
1061890488 9:133616730-133616752 GGACTCCCAAGACCAGCACCTGG - Intergenic
1062304291 9:135894267-135894289 GGACCACCATCACCAGCACCTGG + Intronic
1186457385 X:9720665-9720687 GGTGCCCCAAATCCACCACCTGG - Intergenic
1189522026 X:41779493-41779515 GGATCCCCAAGACCACCCCCAGG - Intronic
1189854332 X:45208902-45208924 GGCCCGCTATAACCACTACCTGG + Intergenic
1190015224 X:46820529-46820551 GGCCCTCTGTAACCACCACCTGG - Intergenic
1190060105 X:47205305-47205327 AGACTCCCCCAACCACCACCAGG - Intronic
1194500793 X:94678845-94678867 GGTCCACTGTAACCACCACCTGG + Intergenic
1196841674 X:119865010-119865032 ACACCTGCATAACCACCACCCGG - Intergenic
1200152203 X:153956745-153956767 GGGCCCCCTTAAGCACCACCTGG + Exonic