ID: 904594594

View in Genome Browser
Species Human (GRCh38)
Location 1:31635402-31635424
Sequence GACCCCCATAACCACCACCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 6, 3: 18, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904594591_904594594 -10 Left 904594591 1:31635389-31635411 CCTCCAGGGGCAGGACCCCCATA 0: 2
1: 1
2: 1
3: 17
4: 152
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594584_904594594 11 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594581_904594594 17 Left 904594581 1:31635362-31635384 CCTCCACCAGCTGGTGGTCCATA 0: 1
1: 1
2: 0
3: 14
4: 132
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594580_904594594 18 Left 904594580 1:31635361-31635383 CCCTCCACCAGCTGGTGGTCCAT 0: 1
1: 1
2: 1
3: 16
4: 181
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594588_904594594 -1 Left 904594588 1:31635380-31635402 CCATAAGGCCCTCCAGGGGCAGG 0: 2
1: 0
2: 1
3: 21
4: 220
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594590_904594594 -9 Left 904594590 1:31635388-31635410 CCCTCCAGGGGCAGGACCCCCAT 0: 2
1: 0
2: 0
3: 23
4: 195
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594577_904594594 26 Left 904594577 1:31635353-31635375 CCATAGGGCCCTCCACCAGCTGG 0: 1
1: 1
2: 2
3: 17
4: 167
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194
904594582_904594594 14 Left 904594582 1:31635365-31635387 CCACCAGCTGGTGGTCCATAAGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG 0: 1
1: 1
2: 6
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904594594 Original CRISPR GACCCCCATAACCACCACCA GGG Exonic
900796717 1:4712524-4712546 CACCACCACCACCACCACCACGG + Exonic
901526762 1:9828049-9828071 AGCACCCAGAACCACCACCAGGG + Intergenic
904239042 1:29132230-29132252 GACCCCCATCACCACCTCCCAGG - Intergenic
904390566 1:30182879-30182901 GGCCCCCATCACCACCACCAAGG - Intergenic
904594594 1:31635402-31635424 GACCCCCATAACCACCACCAGGG + Exonic
906382465 1:45341451-45341473 AACCCCCATACCCAACCCCAAGG + Exonic
908203190 1:61818838-61818860 GACCCCCATTCCCACCTCCATGG - Intronic
908266256 1:62382103-62382125 GACACCCCCAACCACCACCCTGG - Intergenic
911741302 1:101388897-101388919 GACCCACATTGCCAACACCATGG - Intergenic
912520369 1:110240749-110240771 GACGACCACCACCACCACCAGGG + Intronic
913975100 1:143449730-143449752 GACCCCCATGATCACCGACAGGG + Intergenic
914069492 1:144275346-144275368 GACCCCCATGATCACCGACAGGG + Intergenic
914109663 1:144691008-144691030 GACCCCCATGATCACCGACAGGG - Intergenic
916674798 1:167055969-167055991 GAGCCCCATGTCCACCTCCAGGG + Intronic
918132896 1:181644880-181644902 GCCCCCCATCATCACCAGCAGGG + Intronic
918332878 1:183476038-183476060 GATTCCCACAACCACCACCTAGG - Intronic
920084588 1:203406037-203406059 TAGCCCCATAAGCACAACCAAGG + Intergenic
920238944 1:204529549-204529571 GACCCCCATAGCCACCACCAGGG + Intronic
922615720 1:226960245-226960267 TACCACCACCACCACCACCAAGG - Intronic
1065692344 10:28347488-28347510 GACCCCCAGCACCACCACATTGG + Intergenic
1066421361 10:35267536-35267558 TACCCCCATGCCCACCACCATGG - Intronic
1067295179 10:44971565-44971587 GACCCCCATGCCCCCCACCAGGG + Intronic
1073208805 10:101782437-101782459 CACCACCACCACCACCACCAAGG + Intronic
1074549483 10:114429363-114429385 GAGCCCCAACACTACCACCAAGG - Intergenic
1077156806 11:1095733-1095755 GACACCCATCACCACCACTACGG + Intergenic
1077875223 11:6298980-6299002 GACCTCCCTTACCACCTCCAAGG - Intergenic
1078081162 11:8205709-8205731 GACCCCCATGGGCACGACCATGG + Intergenic
1078196584 11:9141879-9141901 GGCCTCCAACACCACCACCAAGG + Intronic
1078390330 11:10931285-10931307 GCCCCCCAGCACCACCACCACGG - Intergenic
1083310173 11:61779906-61779928 GAAGGCCATGACCACCACCAGGG - Exonic
1084149330 11:67280899-67280921 GACCCCCATAGCCACGGCCCTGG - Intronic
1085314519 11:75536315-75536337 GGCTCCCATAATCACCTCCAAGG + Intergenic
1088459265 11:110065319-110065341 CACCCCCACAACCACCTCCTGGG + Intergenic
1089261469 11:117226751-117226773 GAACCACAGAACCACCTCCAGGG + Intronic
1089389852 11:118093347-118093369 GACTCCTTCAACCACCACCAAGG + Intronic
1091508389 12:1096781-1096803 CACCCTCATAACCACTACCTAGG + Intronic
1092684624 12:11028157-11028179 GACTTTCATGACCACCACCAAGG + Intronic
1092689316 12:11089234-11089256 GACTTTCATGACCACCACCAAGG + Intronic
1092692668 12:11131059-11131081 GACTTTCATGACCACCACCAAGG + Intronic
1093528712 12:20135725-20135747 GACCCACATAACAACCAGCCTGG + Intergenic
1096113535 12:49042230-49042252 CACCCCCACAACCCCCACCACGG - Exonic
1096563182 12:52451706-52451728 GGCCCCCAAAGCCACCAGCAAGG + Exonic
1096565334 12:52473365-52473387 GGCCCCCAAAGCCACCAGCAAGG + Exonic
1096567354 12:52492816-52492838 GGCCCCCAAAGCCACCAGCAAGG + Exonic
1097973280 12:65657933-65657955 AACCCCCATCACCACCCCAAAGG + Intergenic
1100340896 12:93678341-93678363 GACCTGCACCACCACCACCAAGG - Intronic
1102659131 12:114510017-114510039 CACCCACATAACCACCACTGAGG - Intergenic
1103836895 12:123828968-123828990 GACCCTCTAATCCACCACCAGGG + Intronic
1104198156 12:126561341-126561363 GACCCACACATCCACCACCCGGG + Intergenic
1104718484 12:131031675-131031697 GACCCCCAGGGCCACCTCCATGG + Intronic
1105813140 13:24011607-24011629 GACCCTCAGATCCACCAACAAGG + Intronic
1105849689 13:24323068-24323090 GGCGCCCAAAGCCACCACCAAGG + Intergenic
1106106346 13:26736708-26736730 GTCCCCTCTAACCACCAGCATGG - Intergenic
1108058547 13:46509548-46509570 CACTCCCACAACCTCCACCAGGG - Intergenic
1108179693 13:47828612-47828634 TAGCCGCGTAACCACCACCAAGG + Intergenic
1113396257 13:109950371-109950393 AACCTCCATACCTACCACCATGG - Intergenic
1113452322 13:110419981-110420003 GACCACCATAACCCCCATCCTGG - Intronic
1114485324 14:23058214-23058236 GCCTCCCACAACTACCACCAGGG - Intergenic
1114791831 14:25668309-25668331 TACCACCGTAACCACTACCAGGG - Intergenic
1118229740 14:63936859-63936881 CACCTCCATCACCACCACCCTGG - Intronic
1121426959 14:93859204-93859226 GACCACCACAGCTACCACCAGGG + Intergenic
1121762273 14:96455853-96455875 TACCCCCACCACCACCACCAGGG - Intronic
1124030135 15:26003117-26003139 GACTCCCATTTCCACCACCTTGG + Intergenic
1124590689 15:31050504-31050526 GCCACCCATGGCCACCACCAAGG - Exonic
1125310853 15:38376601-38376623 AACCCCCAAAACCCCAACCATGG - Intergenic
1129224637 15:74161606-74161628 CACCACCACCACCACCACCAGGG - Intergenic
1129470706 15:75751888-75751910 GAGCCCCAAAACCCTCACCAAGG + Intergenic
1130292429 15:82614324-82614346 CACCCACATAACCACTACCCAGG - Intronic
1131035923 15:89221929-89221951 CCCCCCCACCACCACCACCAGGG + Intergenic
1132828698 16:1917409-1917431 GACTCCCAGGACCACCAACAAGG + Intronic
1133085626 16:3360561-3360583 GACAGACAAAACCACCACCAAGG + Intergenic
1133732871 16:8591106-8591128 CACCACCATCACCATCACCACGG + Intergenic
1133732911 16:8591321-8591343 CACCACCATCACCATCACCATGG + Intergenic
1135817704 16:25650887-25650909 CACCCCCATCACAACCTCCATGG - Intergenic
1137686998 16:50393237-50393259 GACCCCCATACCCTGCCCCATGG + Intergenic
1138356330 16:56383890-56383912 GACCCCCACCACCACCACCAGGG - Intronic
1138583904 16:57958360-57958382 GACCCCTCCCACCACCACCAGGG + Intronic
1139015791 16:62687305-62687327 GACTCACACAACCACCACTAAGG - Intergenic
1139595003 16:67952291-67952313 GACCCCCACAAACACCACCAGGG + Exonic
1139659844 16:68413176-68413198 GACAGCCATCACCACCACCCTGG - Intronic
1140160917 16:72493096-72493118 GACCCCCATAATTATTACCAGGG + Intergenic
1140279995 16:73545193-73545215 GACCCCCATAATGACATCCAGGG + Intergenic
1140625836 16:76793365-76793387 AACCCCTATCACCTCCACCAGGG - Intergenic
1140987368 16:80171204-80171226 TACTACCATCACCACCACCAGGG + Intergenic
1143452233 17:7043009-7043031 GACGCCCCCAACCATCACCACGG + Exonic
1143556862 17:7667605-7667627 AACACCCATCTCCACCACCAGGG + Intronic
1143585524 17:7848553-7848575 CACCACCACCACCACCACCACGG + Exonic
1143901638 17:10178895-10178917 GAGCCCTACAACCACCACCTTGG + Intronic
1146254965 17:31386669-31386691 GACACACATAATCACCACCCAGG + Intergenic
1147560387 17:41505325-41505347 CACCTCCATAGCCACCTCCAAGG + Exonic
1149430763 17:56594261-56594283 CAGCCCCAGGACCACCACCAGGG - Exonic
1150215689 17:63467754-63467776 GACCCTCATAAGCACCTTCAAGG + Intergenic
1151538562 17:74752358-74752380 TACCCCCAAAACCACACCCAGGG + Intronic
1153564091 18:6401866-6401888 GAGCTCCATAACCAGAACCAGGG + Intronic
1155733346 18:29189849-29189871 TTCCCCCATCACCACCATCAAGG - Intergenic
1160792599 19:929480-929502 CACCACCACCACCACCACCACGG - Exonic
1160877813 19:1305362-1305384 GACCCCCACCACCACCATCTCGG + Intergenic
1161547609 19:4891276-4891298 GACCCGCTTCAACACCACCAAGG - Exonic
1161579955 19:5075266-5075288 GGCCCCCGGAACCAACACCAGGG - Intronic
1162478577 19:10915261-10915283 CACCCCCATCCCCACCATCAGGG - Intronic
1163571863 19:18087022-18087044 CGCCACCATCACCACCACCACGG - Intronic
1165065025 19:33223971-33223993 CACCACCACCACCACCACCAGGG + Intronic
1165675442 19:37718917-37718939 GATCCCAATACCTACCACCATGG + Intronic
1167749659 19:51372046-51372068 CACCGCCATGGCCACCACCATGG + Exonic
926337962 2:11878592-11878614 GACCGCCATCACCACCACGCTGG - Intergenic
927489343 2:23510441-23510463 GCTCACCATCACCACCACCATGG - Intronic
928997074 2:37303897-37303919 AACCCACATAACCACCACTCAGG + Intronic
931244990 2:60485044-60485066 CACCCTCACCACCACCACCAAGG + Intronic
932855622 2:75231249-75231271 GACTCACATAACCACCACATGGG - Intergenic
933341602 2:81033396-81033418 CACCACCACCACCACCACCATGG + Intergenic
934290093 2:91684964-91684986 GACCCCCATGATCACCGACAGGG + Intergenic
936577760 2:113669799-113669821 GACCTCCAGATCCACCCCCAGGG - Intergenic
936849090 2:116874008-116874030 GTCTCCCATAACCAACACAATGG - Intergenic
937261778 2:120591297-120591319 ACCCACCATTACCACCACCAAGG + Intergenic
945055842 2:205868378-205868400 ACCCCCCACAACCACCACCCGGG + Intergenic
948601548 2:239110397-239110419 GACCCCAGTCACCGCCACCAAGG - Intronic
948644292 2:239393976-239393998 CACCCCCAACCCCACCACCAGGG + Intronic
948857995 2:240739385-240739407 TCCTCCCATAACCATCACCAAGG - Intronic
949045151 2:241869516-241869538 CACGCCCACCACCACCACCACGG + Intergenic
1172304636 20:33872261-33872283 TACTCCAATAACCACCCCCATGG - Intergenic
1173793433 20:45842484-45842506 TATCCCCACTACCACCACCAAGG + Intronic
1174650979 20:52125360-52125382 GACAGCCATAACCATGACCAAGG + Intronic
1174733152 20:52937979-52938001 CACCACCATCACCACCACTAGGG + Intergenic
1174913333 20:54630203-54630225 CACCTCCATCACCACCACCTTGG - Intronic
1176119352 20:63447018-63447040 CACCCCCATAGCCACCTCCCGGG + Intronic
1179005674 21:37512076-37512098 CACCACCATCACCACCACCATGG + Exonic
1179881761 21:44296014-44296036 GCCCCCGACAAGCACCACCAGGG - Intronic
1181509166 22:23381334-23381356 CACGGCCATAACCACCATCATGG - Intergenic
1181838240 22:25628958-25628980 TACCACCATCACCACCCCCAAGG - Intronic
1182763881 22:32744752-32744774 CACCACCACCACCACCACCAAGG + Intronic
1184496605 22:44846014-44846036 CCCCCCCATCCCCACCACCAAGG + Intronic
1184848414 22:47103150-47103172 CACCCCCAAATCCACCACCTTGG - Intronic
950114619 3:10442607-10442629 TCCCCCCATCACCACTACCATGG - Intronic
950449182 3:13055997-13056019 GACCCCCAAAGGCTCCACCAAGG + Intronic
951196153 3:19826038-19826060 CACCTGCATAACCACCACCCAGG + Intergenic
953573993 3:44098179-44098201 GGCCCACATAACCCTCACCAGGG + Intergenic
954244353 3:49318928-49318950 AACCACCATCACCACCACCAAGG + Intronic
954415505 3:50391365-50391387 TGCCACCAAAACCACCACCAGGG - Intronic
954468981 3:50675322-50675344 GTCCCCCAGAACCCCCGCCACGG - Intronic
956805953 3:72811666-72811688 TTCCCCCATCCCCACCACCAGGG + Intronic
958174639 3:89981161-89981183 GACCCAAATATCCATCACCAAGG + Intergenic
962092689 3:132261880-132261902 CACCACCACCACCACCACCAGGG + Intronic
962630350 3:137269548-137269570 CACCCCCATCACCACCACCAGGG - Intergenic
962697191 3:137961852-137961874 CACCACCATCACCACCACCATGG - Intergenic
965433635 3:168620086-168620108 CACCACCATGACCACCTCCAAGG - Intergenic
968511022 4:996038-996060 TACCCCCATAGCCTCCACCTGGG + Intronic
969829476 4:9782919-9782941 GACCCCCATGATCACCGACAGGG - Exonic
970531375 4:16988954-16988976 CAATCCCATGACCACCACCATGG + Intergenic
972987050 4:44777643-44777665 GGCCCACAGAACAACCACCACGG + Intergenic
973653049 4:53016242-53016264 GATCTCCAAAACCAACACCAAGG - Intronic
975903243 4:79178751-79178773 CATCCCAACAACCACCACCAAGG - Intergenic
983774384 4:171587933-171587955 GACACCTATTACCACCTCCAAGG - Intergenic
985204427 4:187519781-187519803 TACCTCCATAACTACCATCATGG - Intergenic
993149826 5:84146942-84146964 AACCCATATAACAACCACCAAGG + Intronic
996386831 5:122917606-122917628 GACGCACATCACCACCACCGTGG - Intronic
997740388 5:136248009-136248031 GATCCCCCTTACCCCCACCACGG + Intronic
998821277 5:146060004-146060026 GGACCCCATCTCCACCACCACGG - Exonic
998935114 5:147226661-147226683 CACCCCCATGCCCACCACCATGG + Intergenic
1000134811 5:158337082-158337104 AACCCCCACCACCACCCCCAGGG - Intergenic
1003460456 6:6323533-6323555 CACCCTCACAACCACCTCCACGG + Intergenic
1003921303 6:10835889-10835911 CACCCCCATCACCACCGCCCTGG + Intronic
1004548438 6:16622364-16622386 AACCACCACCACCACCACCATGG - Intronic
1004720041 6:18261057-18261079 GACCCCTAGATTCACCACCAAGG + Intronic
1006008827 6:31025569-31025591 GACCACCATGGCCTCCACCATGG + Exonic
1006340384 6:33443433-33443455 CACCACCATCACCACCACCGAGG + Exonic
1006360531 6:33584648-33584670 GACCCCCTAAACCTCCCCCAAGG - Intergenic
1007250380 6:40491054-40491076 GACCGCCATCTCCACCGCCATGG - Intronic
1007299445 6:40855807-40855829 CACCCCCAAAACCTCCCCCATGG + Intergenic
1007601743 6:43086346-43086368 GGCCCCCATAACCACCCCCAGGG - Intronic
1008178288 6:48294959-48294981 CACCCATATAACCACCACCCAGG + Intergenic
1008557504 6:52688642-52688664 GACCCCTCTTACCACCATCATGG + Intergenic
1010016311 6:71108421-71108443 GCCCCACAAAACCTCCACCATGG - Intergenic
1011385384 6:86791864-86791886 TACCCCCATCACCATCACCAGGG + Intergenic
1012910440 6:105111974-105111996 GAACACCATAATCACCACCATGG + Intronic
1013075421 6:106766542-106766564 CACCCCCATCACCACCACCAAGG + Intergenic
1018062787 6:160103649-160103671 CACCCCCATCTGCACCACCAGGG - Intronic
1018140611 6:160830318-160830340 GACCCCCACAAACACCAACTCGG + Intergenic
1018704059 6:166450300-166450322 GACCACCATAGGGACCACCAGGG + Intronic
1019938660 7:4272355-4272377 CACCCCCATGGCCTCCACCATGG + Intergenic
1022529626 7:31058720-31058742 GACCCCCACACACACCTCCAGGG - Intronic
1023295264 7:38708227-38708249 GACTCCCAAAATCACCAGCAGGG - Intergenic
1024576944 7:50772087-50772109 GACCTCCTTCAACACCACCACGG + Intronic
1028466633 7:91159823-91159845 GTGTCCCATAAACACCACCATGG - Intronic
1028985583 7:97006245-97006267 CACCACCAGCACCACCACCACGG + Exonic
1029710290 7:102295481-102295503 CACCACCACCACCACCACCATGG - Intronic
1034400115 7:150856641-150856663 GCCCTCCAGTACCACCACCATGG + Exonic
1034700025 7:153087801-153087823 GACCCCCAAAATCTCCCCCATGG - Intergenic
1034895338 7:154872718-154872740 GAGCCCCAGAACGAGCACCAGGG - Intronic
1037288424 8:17325264-17325286 GACCGTCATACCCACCACGATGG + Intronic
1038424864 8:27458569-27458591 GACCCACATGACCAACAGCAAGG - Exonic
1040023439 8:42761007-42761029 GACTCCCTCAGCCACCACCATGG - Intronic
1041669661 8:60479676-60479698 GACACCCACCACCACAACCACGG + Intergenic
1049585196 8:143429781-143429803 CACCACCACCACCACCACCATGG - Exonic
1049664472 8:143836875-143836897 AACCCCCATGACCCCCACAAGGG + Intronic
1049835398 8:144732348-144732370 GACCCATACACCCACCACCAAGG - Intronic
1050138304 9:2491298-2491320 GACCCCCATAACTCTCCCCAGGG + Intergenic
1055426196 9:76199594-76199616 GACCTCCCTGACCACCACCAAGG - Intronic
1056946732 9:91003963-91003985 GACCACCATGACCAGCATCAGGG - Intergenic
1057031072 9:91775603-91775625 TTCCACCATACCCACCACCAGGG + Intronic
1057140114 9:92721603-92721625 GACACCCATTACCACATCCAAGG + Intronic
1059257531 9:112945040-112945062 GACCCCTGAAACCATCACCACGG - Intergenic
1061996009 9:134186430-134186452 CACCCTCAAGACCACCACCAAGG - Intergenic
1062287300 9:135778890-135778912 GACCCCCACAGCCACGACCACGG + Intronic
1062287312 9:135778926-135778948 GACCCCCACAGCCACGACCACGG + Intronic
1062287324 9:135778962-135778984 GACCGCCACAGCCACGACCACGG + Intronic
1062287345 9:135779034-135779056 AACCCCCACAACCACAGCCATGG + Intronic
1062522530 9:136964170-136964192 AAGCCCCAGAACCACCTCCAGGG - Intergenic
1187296930 X:18011342-18011364 GACCTCCATCTCTACCACCATGG - Intergenic
1189097042 X:38151511-38151533 AACCCCCACCACCACCACCACGG + Intronic
1189852848 X:45194223-45194245 GACCTCCATACCCAACCCCAAGG + Intronic
1190128615 X:47726430-47726452 AATCCCCCTGACCACCACCAAGG - Intergenic
1193493798 X:82185836-82185858 CACCACCACCACCACCACCATGG + Intergenic
1193556701 X:82962087-82962109 GACAACTATAACCAGCACCAGGG + Intergenic
1195905594 X:109841041-109841063 GACCCCCAGAGCCATCACAAAGG + Intergenic
1196141132 X:112264914-112264936 GTTCCCCATAAGCACCAGCATGG + Intergenic
1196189429 X:112779432-112779454 TGCCACCATCACCACCACCATGG - Exonic
1196841673 X:119865009-119865031 CACCTGCATAACCACCACCCGGG - Intergenic
1199783955 X:151087515-151087537 AACCTCCATGACCACCACCCTGG + Intergenic
1199978029 X:152905763-152905785 GACCACCAGCACCAGCACCAAGG - Intergenic
1201038312 Y:9804858-9804880 GACTCCTATGACCATCACCATGG - Intergenic