ID: 904594595

View in Genome Browser
Species Human (GRCh38)
Location 1:31635403-31635425
Sequence ACCCCCATAACCACCACCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 242}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904594581_904594595 18 Left 904594581 1:31635362-31635384 CCTCCACCAGCTGGTGGTCCATA 0: 1
1: 1
2: 0
3: 14
4: 132
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594588_904594595 0 Left 904594588 1:31635380-31635402 CCATAAGGCCCTCCAGGGGCAGG 0: 2
1: 0
2: 1
3: 21
4: 220
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594577_904594595 27 Left 904594577 1:31635353-31635375 CCATAGGGCCCTCCACCAGCTGG 0: 1
1: 1
2: 2
3: 17
4: 167
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594584_904594595 12 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594591_904594595 -9 Left 904594591 1:31635389-31635411 CCTCCAGGGGCAGGACCCCCATA 0: 2
1: 1
2: 1
3: 17
4: 152
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594582_904594595 15 Left 904594582 1:31635365-31635387 CCACCAGCTGGTGGTCCATAAGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594590_904594595 -8 Left 904594590 1:31635388-31635410 CCCTCCAGGGGCAGGACCCCCAT 0: 2
1: 0
2: 0
3: 23
4: 195
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242
904594580_904594595 19 Left 904594580 1:31635361-31635383 CCCTCCACCAGCTGGTGGTCCAT 0: 1
1: 1
2: 1
3: 16
4: 181
Right 904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG 0: 1
1: 1
2: 6
3: 28
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904594595 Original CRISPR ACCCCCATAACCACCACCAG GGG Exonic
900120495 1:1046715-1046737 ACCCCCAGAGCCACCCCCACTGG - Exonic
900585691 1:3431300-3431322 ACCCCCCCACCCACCCCCAGGGG + Intronic
904344674 1:29859973-29859995 ATCCCCATAACCACCCTGAGAGG - Intergenic
904594595 1:31635403-31635425 ACCCCCATAACCACCACCAGGGG + Exonic
905358885 1:37404685-37404707 ACCCCCATTTCCACCATCACTGG + Intergenic
909271415 1:73627728-73627750 ACCCCCATGGTCACCACCAGTGG - Intergenic
910304475 1:85746956-85746978 AAACCCATAATCACCAGCAGGGG - Intronic
910515273 1:88053833-88053855 ACCCCTCTAGCCACCACCACTGG + Intergenic
912525692 1:110281056-110281078 ACCACCACCACCACCACCACAGG - Intronic
912884118 1:113450672-113450694 AGATCCATAACCACCACCATAGG - Intronic
913171160 1:116233598-116233620 CCCTCCATAGCCACCACCATAGG - Intergenic
915220972 1:154374139-154374161 ACCACCACCACCACCACCACCGG + Intergenic
915936258 1:160091896-160091918 ACCCCTGTACCCACCAGCAGAGG + Exonic
917991010 1:180378831-180378853 ACAGCCACCACCACCACCAGTGG + Intronic
918132898 1:181644881-181644903 CCCCCCATCATCACCAGCAGGGG + Intronic
919169898 1:193939911-193939933 ACCCCTATGGCCACCACCACTGG - Intergenic
919522513 1:198606101-198606123 ACCCCCATTCCCAACCCCAGAGG - Intergenic
920238945 1:204529550-204529572 ACCCCCATAGCCACCACCAGGGG + Intronic
920366622 1:205451291-205451313 TCCCCCACACCTACCACCAGTGG + Intronic
920525713 1:206664369-206664391 ATCCCGATATTCACCACCAGGGG - Intronic
921011965 1:211150630-211150652 ACCCCTGTGACCACCACCACTGG - Intergenic
921823231 1:219641174-219641196 ACCCCTGTGACCACCACCACTGG - Intergenic
922467374 1:225853532-225853554 ACCCCCACTACCCCCACTAGTGG - Intronic
1065023062 10:21516767-21516789 ACCACCACCACCACCACCACCGG - Exonic
1065231748 10:23605700-23605722 ACCCCCATCTCCACCAGCAAAGG + Intergenic
1065539809 10:26751691-26751713 TCCCCCACCACCACCACCAGTGG - Exonic
1066496713 10:35949182-35949204 ACACCAAGAACCACCCCCAGTGG + Intergenic
1067156815 10:43789288-43789310 AGATCCATAACCACCACCATAGG + Intergenic
1067428424 10:46226494-46226516 CACCCCACACCCACCACCAGGGG - Intergenic
1068813295 10:61280956-61280978 ACCACCAGAGGCACCACCAGTGG + Intergenic
1071218625 10:83436557-83436579 ACCACCACTACCACCACCACTGG + Intergenic
1072492212 10:95919548-95919570 ACTCCCATGGCCACCACCACTGG + Intronic
1073708092 10:106010109-106010131 ACCCCTGTGACCACCACCATTGG + Intergenic
1075496486 10:122923525-122923547 ACCCCCGTGGCCACCAGCAGTGG - Intergenic
1077075119 11:697002-697024 ACCCCCCCCACCACCACCACCGG - Intronic
1077187762 11:1243118-1243140 ACCACCACACCCACAACCAGAGG + Exonic
1077188183 11:1244789-1244811 ACCACCACACCCACAACCAGAGG + Exonic
1077188718 11:1246889-1246911 ACCACCACACCCACAACCAGAGG + Exonic
1077189138 11:1248560-1248582 ACCACCACACCCACAACCAGTGG + Exonic
1077189707 11:1250759-1250781 ACCACCACACCCACAACCAGTGG + Exonic
1077656169 11:4021130-4021152 ACCACCACCACCACCACCATAGG - Intronic
1078390328 11:10931284-10931306 CCCCCCAGCACCACCACCACGGG - Intergenic
1078933652 11:15933772-15933794 CACCCCACCACCACCACCAGAGG + Intergenic
1080042594 11:27774675-27774697 ACCCCTCTCACCACCACAAGAGG + Intergenic
1081638040 11:44733939-44733961 ACCCCCACAACCTCCAACAGTGG - Intronic
1083932472 11:65853484-65853506 CCCCCTATCACCACCACCACAGG + Exonic
1084939639 11:72605689-72605711 ACACCCATAACCCCAGCCAGGGG + Intronic
1085260668 11:75202985-75203007 GACCCCATCACCACCACCAATGG - Intronic
1085831931 11:79910853-79910875 AACCCCATAACCCCCAACACTGG + Intergenic
1085969807 11:81574333-81574355 ATCCCCATAACCCCCACGTGTGG + Intergenic
1087222053 11:95557141-95557163 AGCACCATAACCACCACAAAAGG - Intergenic
1089073883 11:115721619-115721641 ACCCCCAGCAGCCCCACCAGGGG - Intergenic
1089578743 11:119468365-119468387 ACCCCTTTAGCCACCACCACTGG + Intergenic
1091409073 12:227424-227446 ACCCCCATATCCAACACCCCAGG - Intronic
1092373217 12:7934333-7934355 ACCCCCTCCACCACCACCAGTGG - Intronic
1094056280 12:26272617-26272639 AACCCCCTGACCACCACCACCGG - Intronic
1098333676 12:69380510-69380532 ACCCCTTTAGCCACCACCACTGG + Intronic
1098395302 12:70010907-70010929 ATCCCCATAACCACCACAGCTGG - Intergenic
1099523423 12:83690868-83690890 ACCCCCATGGCCAGCACCACTGG - Intergenic
1100380234 12:94054948-94054970 ACCACCATCACCACCACCAGAGG + Intergenic
1102888741 12:116541673-116541695 ATTCCCATAACCACTACAAGAGG - Intergenic
1102999487 12:117374603-117374625 CCCCCCATCACCACCACCAGAGG + Intronic
1103673506 12:122637782-122637804 ATCCCCATTCCCACCAGCAGCGG + Intergenic
1104878021 12:132050053-132050075 AGCCCCATAATCACCCCAAGAGG - Intronic
1109683896 13:65787971-65787993 AGATCCATAACCACCACCATAGG + Intergenic
1110901595 13:80831751-80831773 ACCCCTGTGACCACCACCACTGG - Intergenic
1113212832 13:108002744-108002766 ACCCCTGTGGCCACCACCAGTGG + Intergenic
1113707111 13:112442099-112442121 CCCCACATAACCACCTACAGTGG + Intergenic
1114485322 14:23058213-23058235 CCTCCCACAACTACCACCAGGGG - Intergenic
1117171579 14:53105957-53105979 ACCACCACCACCACCACCACAGG - Intronic
1117208350 14:53469425-53469447 ACCCCTGTAGCCACCACCACTGG + Intergenic
1117629477 14:57675120-57675142 CCTCCTCTAACCACCACCAGAGG - Intronic
1118316662 14:64729973-64729995 ACCCCCATACCCACCTCGGGAGG - Intronic
1118735411 14:68697315-68697337 ACCGCCACCACCACCAACAGAGG - Intronic
1119253610 14:73179265-73179287 ACCCACATTACCATCACCACAGG + Intronic
1119562915 14:75605247-75605269 ACCACCATCACCATCACCATAGG + Intronic
1119662519 14:76462159-76462181 ACCACCACCACCACCACCACAGG - Intronic
1120758600 14:88266576-88266598 ACCACCACCACCACCACCACTGG - Intronic
1120888228 14:89468753-89468775 ACCTCGATATTCACCACCAGGGG - Intronic
1122722601 14:103730583-103730605 ACCCCCCAAGCCACCACAAGGGG - Intronic
1123928409 15:25142119-25142141 ACCCTTATAATCACTACCAGAGG - Intergenic
1125310852 15:38376600-38376622 ACCCCCAAAACCCCAACCATGGG - Intergenic
1127107747 15:55635056-55635078 ACACCCAGAACCAACAACAGAGG - Intronic
1127477016 15:59344425-59344447 ACCCCTATGGCCACCACCACTGG + Intronic
1129224636 15:74161605-74161627 ACCACCACCACCACCACCAGGGG - Intergenic
1129299355 15:74616340-74616362 TCCCCTGTAACCGCCACCAGTGG - Intronic
1129501177 15:76038848-76038870 ACCCCTATAGCCACCACCAGTGG - Intronic
1129514176 15:76146851-76146873 ACCTCCATCACCACACCCAGGGG + Intronic
1129724991 15:77897155-77897177 CCCCCCTTGGCCACCACCAGTGG - Intergenic
1132795401 16:1718816-1718838 ACCCCCAGAAGCCCCATCAGAGG + Intronic
1135180847 16:20272957-20272979 AACCCCATACCCACCCACAGAGG + Intergenic
1135887056 16:26319811-26319833 TACCCCATCACCACCACCTGGGG + Intergenic
1136298692 16:29318816-29318838 TCCCCCATGACCACAGCCAGCGG + Intergenic
1136646650 16:31624938-31624960 ACCACCACCACCACCACCAAAGG + Intergenic
1137598851 16:49742850-49742872 ACCCCTAAAACCAGAACCAGTGG + Intronic
1138080857 16:54090127-54090149 ACCCACATATCCATCAACAGAGG + Intronic
1138356329 16:56383889-56383911 ACCCCCACCACCACCACCAGGGG - Intronic
1138524042 16:57591553-57591575 ATTCCCATAGCAACCACCAGGGG + Intronic
1139481251 16:67231945-67231967 AAGCCCATGCCCACCACCAGAGG + Intronic
1140321759 16:73959441-73959463 ATCCTCACAACCACCCCCAGAGG + Intergenic
1141946755 16:87315932-87315954 CCCCCCATCCCCACCACCCGTGG - Intronic
1142060354 16:88025313-88025335 TCCCCCATGACCACAGCCAGCGG + Intronic
1142148306 16:88501800-88501822 ACCTCCATCACCAGCACCAGCGG - Intronic
1142767319 17:2072172-2072194 ACCCCCCTCACCCCCACCAGAGG - Intronic
1143012352 17:3872886-3872908 ACCACCATTACCGCCACCTGTGG + Intronic
1146555922 17:33823951-33823973 GCCCCCATAACCAGCTGCAGGGG + Intronic
1147625538 17:41897487-41897509 ACCCCCATAAGAAGAACCAGGGG + Intronic
1149111203 17:53033137-53033159 ACCCCCGTGGCCACCACCACTGG + Intergenic
1151980223 17:77504162-77504184 ACCCCCAAAACCAGATCCAGCGG - Intergenic
1153564092 18:6401867-6401889 AGCTCCATAACCAGAACCAGGGG + Intronic
1160122544 18:76143700-76143722 ACCCCAACCACCACCACGAGAGG + Intergenic
1160147770 18:76378793-76378815 ACCCCCAGAACCACCCCCGGAGG - Intronic
1160300590 18:77674252-77674274 ACCCCCGTGACCTCCACCAATGG - Intergenic
1160792598 19:929479-929501 ACCACCACCACCACCACCACGGG - Exonic
1161579954 19:5075265-5075287 GCCCCCGGAACCAACACCAGGGG - Intronic
1161698980 19:5784803-5784825 ACACCCAGAACCCCAACCAGTGG - Intronic
1161812524 19:6478920-6478942 ACCCCCATATCCCGCACCTGAGG + Exonic
1164739260 19:30564520-30564542 ACCACCAGGACCACCAGCAGTGG - Intronic
1165186349 19:34025704-34025726 AACCACATCACCACCACCACAGG + Intergenic
1166379916 19:42350456-42350478 TCCCCCACACCCCCCACCAGGGG - Intronic
925698840 2:6612967-6612989 ACCCCTGTAACCACCAACACTGG + Intergenic
925780792 2:7380064-7380086 ACCACCATAACCACCACCACCGG - Intergenic
925821642 2:7804965-7804987 ATCCCCATAACCCTCTCCAGTGG + Intergenic
926183493 2:10667717-10667739 ATCCCCATAACAACCCCCCGAGG - Intronic
926975597 2:18513949-18513971 ACCACCACCACCACCACCACTGG + Intergenic
928495559 2:31828553-31828575 ACCCCTGTGACCACCACCACTGG + Intergenic
929524316 2:42686384-42686406 ACTCCCATAATCATCACCACAGG + Intronic
929559974 2:42950293-42950315 ATCCCCACAACCACCTCCTGGGG + Intergenic
930096812 2:47571613-47571635 ACCCCCCTACCCGCCACCCGAGG + Intergenic
931510663 2:62989239-62989261 CCCACCATAACCACCACCAAAGG + Intronic
932648689 2:73532150-73532172 ACCCCTGTGGCCACCACCAGTGG + Intronic
932850146 2:75176812-75176834 ACTTCCCTGACCACCACCAGAGG + Intronic
932889599 2:75580379-75580401 ACTCCTATAGCCACCACCACTGG - Intergenic
933341603 2:81033397-81033419 ACCACCACCACCACCACCATGGG + Intergenic
933484150 2:82896839-82896861 AAGCCCAAAACCACTACCAGTGG - Intergenic
933601084 2:84330856-84330878 ACCCCTGTGGCCACCACCAGTGG - Intergenic
937261780 2:120591298-120591320 CCCACCATTACCACCACCAAGGG + Intergenic
938273737 2:129997860-129997882 ACCCCCACAGCCAGCAGCAGTGG - Intergenic
938437289 2:131291993-131292015 ACCCCCACAGCCAGCATCAGTGG + Intronic
938442475 2:131348255-131348277 ACCCCCACAGCCAGCATCAGTGG + Intronic
938994628 2:136665000-136665022 CCCACCATACCCACCACCAGCGG - Intergenic
940622863 2:156134755-156134777 CCCCCCACCACCACCACCACTGG + Intergenic
940803139 2:158154810-158154832 ACCCCTATGACCACCACCACTGG - Intergenic
942099694 2:172567872-172567894 ACCCCTATCACCACCCCCAGTGG + Intronic
944917772 2:204378451-204378473 ACCCCCATACCCCCAACCCGCGG + Intergenic
947632619 2:231663756-231663778 CCCTCCATTTCCACCACCAGAGG - Intergenic
948413718 2:237784957-237784979 ACCACCACCACCACCACCACAGG + Intronic
948429178 2:237908407-237908429 ACCACCACCACCACCACCAGAGG - Intronic
948824981 2:240569694-240569716 ACCCCCTCCACCTCCACCAGTGG + Intronic
1169154812 20:3320778-3320800 ATCCCCATCACCATCACCTGTGG - Intronic
1169318773 20:4613980-4614002 ACCACCACCACCACCACCACTGG + Intergenic
1170330872 20:15209085-15209107 ACCACCACCACCACCACCACAGG - Intronic
1170609095 20:17897098-17897120 GCCACCATCACCACCAACAGGGG + Intergenic
1172424327 20:34845135-34845157 ACCACCACCACCACCACCACAGG + Exonic
1172669045 20:36621362-36621384 ACATCCATAAGCACCACCATAGG - Intronic
1173793434 20:45842485-45842507 ATCCCCACTACCACCACCAAGGG + Intronic
1174733153 20:52937980-52938002 ACCACCATCACCACCACTAGGGG + Intergenic
1175761536 20:61565047-61565069 ACCACCAAGAGCACCACCAGTGG - Intronic
1175846923 20:62064546-62064568 ACGCCCACGGCCACCACCAGCGG - Exonic
1176188580 20:63795515-63795537 ACCCCAATAGCCACCAGGAGAGG + Intronic
1181852685 22:25761375-25761397 ACCACCACCACCACCACCTGTGG - Intronic
1182763882 22:32744753-32744775 ACCACCACCACCACCACCAAGGG + Intronic
1183458586 22:37936154-37936176 ACCCACAGGACCACCCCCAGGGG - Intronic
1184169013 22:42748018-42748040 ACCCTCAAATCCACCTCCAGAGG + Intergenic
1184271635 22:43387822-43387844 ACCCCTATAACCCCTAGCAGTGG + Intergenic
1184282660 22:43447073-43447095 ATCCGCAGAACCACCAGCAGGGG - Intronic
1184848413 22:47103149-47103171 ACCCCCAAATCCACCACCTTGGG - Intronic
950114617 3:10442606-10442628 CCCCCCATCACCACTACCATGGG - Intronic
950116046 3:10450830-10450852 ACCCCGACACCCAACACCAGAGG + Intronic
950267423 3:11584929-11584951 ACCACCACCACCACCACCACCGG + Intronic
950718774 3:14867908-14867930 ACCCCCAAAAACACCTCCCGGGG - Intronic
950800966 3:15551654-15551676 ACCCCTATGTCCACCACCACTGG + Intergenic
955330264 3:58041526-58041548 ACCACCACCACCACCACCAGTGG + Intronic
957028773 3:75215571-75215593 AGATCCATAACCACCACCATAGG - Intergenic
959899045 3:111639446-111639468 ACCCCCATCCCCAACAGCAGTGG + Intronic
961534859 3:127564100-127564122 ACCATCATCACCACCACCACTGG + Intergenic
961773763 3:129269138-129269160 AACCCAACAACCACCACCTGAGG - Intronic
962697190 3:137961851-137961873 ACCACCATCACCACCACCATGGG - Intergenic
964964958 3:162481329-162481351 AACCCCATGGCCACCACCACTGG + Intergenic
965035028 3:163426620-163426642 ACCCCTATAGCCACCACCACTGG - Intergenic
965144890 3:164889270-164889292 ACACCCCTAGCCACCACCACTGG + Intergenic
965944734 3:174226292-174226314 ACCCCCTTACCCACCACCCCTGG + Intronic
967202546 3:187085250-187085272 ACCCTCATCACCAACATCAGAGG - Intergenic
967347085 3:188469337-188469359 ACCACCACAACCACCACAACCGG - Intronic
968505256 4:968384-968406 ACACCCATCACCACCACTGGCGG - Exonic
968565148 4:1308359-1308381 ACCCACATGTCCATCACCAGGGG - Intronic
968819085 4:2836621-2836643 ACCCCCACAACGACCATCAGAGG - Exonic
970607351 4:17693056-17693078 AGCCACAGAACCAACACCAGCGG + Intronic
972007436 4:34128245-34128267 ACTCCCATTACCACCACCACTGG - Intergenic
973340133 4:48995171-48995193 ATGCCCATAACCATAACCAGAGG - Intronic
977912618 4:102555466-102555488 ACCAGCATAACCAGCACCTGCGG + Intronic
980442607 4:132867971-132867993 ATTCCTATGACCACCACCAGTGG - Intergenic
980682903 4:136187264-136187286 CTCCCCATAACCACCACAACTGG - Intergenic
981140339 4:141260079-141260101 ACCCCTGTGACCACCACCACTGG - Intergenic
981558499 4:146022463-146022485 ACCCCCATGACAACCACCACTGG + Intergenic
981670930 4:147286342-147286364 ACCGCCATCACCACCATCAAAGG + Intergenic
982339949 4:154285959-154285981 ACCCCTGTGACCACCACCACTGG - Intronic
983780550 4:171665432-171665454 AGCCCCACAGCCCCCACCAGCGG - Intergenic
987053474 5:14167816-14167838 TCCCCCTGACCCACCACCAGTGG + Intronic
987165628 5:15194909-15194931 ACCACCACCACCACCACCACAGG - Intergenic
987898424 5:23979383-23979405 AACCCCATGACCATCACCTGAGG - Intronic
988956274 5:36323668-36323690 ACCCCTATGGCCACCACCACAGG + Intergenic
990867440 5:60395891-60395913 CTGCCCATTACCACCACCAGGGG + Intronic
992285064 5:75226379-75226401 ACCCCTATAGCCACCACCACTGG - Intronic
992398183 5:76386719-76386741 ACCCCCATATCCACCTCCAGTGG - Intergenic
992581461 5:78182741-78182763 ACCCCCATCCCCACCAGTAGAGG + Intronic
993149827 5:84146943-84146965 ACCCATATAACAACCACCAAGGG + Intronic
994660113 5:102642599-102642621 ACCCCCATGGCCATCACCACTGG - Intergenic
996474406 5:123899985-123900007 AACACCATGACCACCACCACTGG - Intergenic
997180507 5:131824072-131824094 ACCCCTGTGACCACCACCAATGG + Intronic
999696480 5:154191649-154191671 ACCCCCTTCTCCACCCCCAGGGG - Intronic
1001925215 5:175631161-175631183 CCCCCCATCACCTCCAGCAGTGG - Intergenic
1003351404 6:5320882-5320904 GCCCCCACAACCACCACGTGAGG - Intronic
1003921304 6:10835890-10835912 ACCCCCATCACCACCGCCCTGGG + Intronic
1007275169 6:40667943-40667965 GCCACCACAACCACCAGCAGTGG - Intergenic
1007960791 6:45957156-45957178 CCTCCCACCACCACCACCAGAGG - Intronic
1012806999 6:103907868-103907890 ACCCCTGTGGCCACCACCAGTGG + Intergenic
1012910441 6:105111975-105111997 AACACCATAATCACCACCATGGG + Intronic
1015561707 6:134523315-134523337 ACCCCCAGAACCCTCACCTGTGG + Intergenic
1017387483 6:153902275-153902297 ACACCTGTAGCCACCACCAGTGG - Intergenic
1018062786 6:160103648-160103670 ACCCCCATCTGCACCACCAGGGG - Intronic
1018704060 6:166450301-166450323 ACCACCATAGGGACCACCAGGGG + Intronic
1019044489 6:169132587-169132609 ACCCCTGTGACCACCACCACTGG - Intergenic
1019208404 6:170382988-170383010 ACCCACACAAGTACCACCAGTGG + Intronic
1019556468 7:1633926-1633948 ACCCCCAAGTCCCCCACCAGGGG - Intergenic
1019938661 7:4272356-4272378 ACCCCCATGGCCTCCACCATGGG + Intergenic
1022529625 7:31058719-31058741 ACCCCCACACACACCTCCAGGGG - Intronic
1022758837 7:33325896-33325918 ACTCCCATGGCCACCACCAATGG + Intronic
1023359794 7:39403833-39403855 ACATCCATCAACACCACCAGTGG + Intronic
1024662381 7:51510801-51510823 ATCCCCATGGCCACCACCACAGG + Intergenic
1029506992 7:100968652-100968674 ACTCCCTGAACCAACACCAGGGG - Intergenic
1029518436 7:101043453-101043475 ACACCCAGAACAACCAGCAGAGG + Exonic
1030057245 7:105594180-105594202 ACCACCACTGCCACCACCAGGGG + Intronic
1031288267 7:119900242-119900264 ACCCCTTTAACCACTACCACTGG + Intergenic
1032130750 7:129225345-129225367 ACCCACATCACCAGCACCAGCGG + Exonic
1034132512 7:148733084-148733106 ACCCGCCTCACCACCACCACTGG - Intronic
1035304081 7:157918928-157918950 ACCCCCACAACAGCCACCTGAGG + Intronic
1037873973 8:22528926-22528948 ACTCCAATAACCAACACCACCGG - Intronic
1041606918 8:59792779-59792801 CCCCCTATAGCCACCACAAGTGG - Intergenic
1042385156 8:68165603-68165625 ATACCCATCACCACCACCACAGG - Intronic
1043750568 8:83929027-83929049 ACCCCTGTGACCATCACCAGTGG + Intergenic
1044066344 8:87704228-87704250 ACCTCCATGGCCACCACCACTGG - Intergenic
1049664473 8:143836876-143836898 ACCCCCATGACCCCCACAAGGGG + Intronic
1050446614 9:5729207-5729229 ACCCCTACCACCTCCACCAGAGG - Intronic
1050864374 9:10479399-10479421 ATCCCCATCCCCACCACTAGGGG - Intronic
1050930082 9:11311923-11311945 ACTCCCATTGCCACCACCACTGG + Intergenic
1051646104 9:19270172-19270194 ACCCCTGCAACCACCACCACTGG + Intronic
1053152973 9:35754575-35754597 TCCCCCACTGCCACCACCAGGGG + Exonic
1054927792 9:70605443-70605465 ACCCCCACCCCCACCCCCAGGGG + Intronic
1056717007 9:89040006-89040028 ACCACCACCACCACCACCATCGG + Intronic
1057031073 9:91775604-91775626 TCCACCATACCCACCACCAGGGG + Intronic
1057228145 9:93303288-93303310 ACCAACAGAACCACGACCAGAGG - Intronic
1057605645 9:96496394-96496416 ACCACCACCACCACCACCACAGG + Intronic
1057644551 9:96860360-96860382 ACCCCTGTAGCCACCACCACTGG - Intronic
1058004058 9:99896382-99896404 ACTCCCGTAACCACCACCACTGG - Intergenic
1062287301 9:135778891-135778913 ACCCCCACAGCCACGACCACGGG + Intronic
1062287313 9:135778927-135778949 ACCCCCACAGCCACGACCACGGG + Intronic
1062287346 9:135779035-135779057 ACCCCCACAACCACAGCCATGGG + Intronic
1062678057 9:137759917-137759939 ACCCCCTGACCCACAACCAGCGG - Intronic
1185703744 X:2251059-2251081 TCCCCCATTAACACCTCCAGGGG + Intronic
1187612923 X:20961661-20961683 ACCACCACCACCACCACCACAGG - Intergenic
1188716288 X:33463647-33463669 ACCCCTGTGACCACCACCACTGG + Intergenic
1188790733 X:34405244-34405266 ACCCCCATTATCTCCACCAAAGG + Intergenic
1189628292 X:42922141-42922163 ACCCCTGTGGCCACCACCAGTGG - Intergenic
1189640899 X:43068851-43068873 ACCCCCGTGGCCACCACCACTGG - Intergenic
1189901361 X:45710246-45710268 ACCCCCACCATCACCACCACAGG - Intergenic
1190037924 X:47042940-47042962 ACCCCTATGGCCACCACCACTGG - Intronic
1190046373 X:47114212-47114234 ACCCCGGTGGCCACCACCAGTGG - Intergenic
1190210895 X:48446945-48446967 TCCCCCTTGACCACCAGCAGAGG + Intergenic
1192203524 X:69081909-69081931 ATCCCCCAAACCACCACCACAGG - Intergenic
1194340558 X:92700346-92700368 ACCCCCATGGCCACCACCACTGG + Intergenic
1194750024 X:97673676-97673698 CCCCCCCAATCCACCACCAGTGG - Intergenic
1195990649 X:110678949-110678971 CCTCTCATACCCACCACCAGAGG + Intronic
1197458076 X:126702260-126702282 ACGCCTGTGACCACCACCAGTGG - Intergenic
1197520282 X:127489500-127489522 ACCCCTGTAGCCACCACCACTGG + Intergenic
1198761140 X:140033422-140033444 AGATCCATAACCACCACCATAGG - Intergenic
1200648913 Y:5817084-5817106 ACCCCCATGGCCACCACCACTGG + Intergenic
1201238901 Y:11938898-11938920 AACCCCACCACCACCATCAGTGG + Intergenic