ID: 904594597

View in Genome Browser
Species Human (GRCh38)
Location 1:31635404-31635426
Sequence CCCCCATAACCACCACCAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 4, 3: 28, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904594584_904594597 13 Left 904594584 1:31635368-31635390 CCAGCTGGTGGTCCATAAGGCCC 0: 2
1: 0
2: 0
3: 3
4: 90
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594582_904594597 16 Left 904594582 1:31635365-31635387 CCACCAGCTGGTGGTCCATAAGG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594580_904594597 20 Left 904594580 1:31635361-31635383 CCCTCCACCAGCTGGTGGTCCAT 0: 1
1: 1
2: 1
3: 16
4: 181
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594581_904594597 19 Left 904594581 1:31635362-31635384 CCTCCACCAGCTGGTGGTCCATA 0: 1
1: 1
2: 0
3: 14
4: 132
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594588_904594597 1 Left 904594588 1:31635380-31635402 CCATAAGGCCCTCCAGGGGCAGG 0: 2
1: 0
2: 1
3: 21
4: 220
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594590_904594597 -7 Left 904594590 1:31635388-31635410 CCCTCCAGGGGCAGGACCCCCAT 0: 2
1: 0
2: 0
3: 23
4: 195
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594577_904594597 28 Left 904594577 1:31635353-31635375 CCATAGGGCCCTCCACCAGCTGG 0: 1
1: 1
2: 2
3: 17
4: 167
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188
904594591_904594597 -8 Left 904594591 1:31635389-31635411 CCTCCAGGGGCAGGACCCCCATA 0: 2
1: 1
2: 1
3: 17
4: 152
Right 904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG 0: 1
1: 1
2: 4
3: 28
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904594597 Original CRISPR CCCCCATAACCACCACCAGG GGG Exonic
900522250 1:3111355-3111377 CCCCCAGCACCACCTTCAGGAGG - Intronic
903604153 1:24562772-24562794 CCCCCACACCCACCCCCAGCTGG + Intronic
903992655 1:27284853-27284875 ACACCATAGTCACCACCAGGGGG - Intronic
904594597 1:31635404-31635426 CCCCCATAACCACCACCAGGGGG + Exonic
905374670 1:37511782-37511804 CCACCACAACCACCACCAAAAGG + Intronic
909271413 1:73627727-73627749 CCCCCATGGTCACCACCAGTGGG - Intergenic
911648262 1:100358380-100358402 CACCCATGACCACCACTAGGAGG - Intronic
915053845 1:153106821-153106843 TCCCCATAACCATCACCCTGTGG - Intergenic
915899998 1:159840042-159840064 CCACCCTAACCACCACCAGGAGG - Intronic
916425338 1:164674856-164674878 CCCCCCCACCCACCACCAAGAGG + Intronic
919777743 1:201205257-201205279 CCCCCCTCACCACCAGCCGGTGG - Exonic
920238947 1:204529551-204529573 CCCCCATAGCCACCACCAGGGGG + Intronic
920447945 1:206034186-206034208 ACCCCATTACCTCCTCCAGGAGG + Intergenic
920525712 1:206664368-206664390 TCCCGATATTCACCACCAGGGGG - Intronic
1064294519 10:14066300-14066322 CCCCCACACCCCCCACCAAGAGG - Intronic
1067112186 10:43408640-43408662 CCCCCGTCCCCACCCCCAGGGGG + Intronic
1069651424 10:70052769-70052791 TCCACATAACCACCTCTAGGAGG - Intergenic
1070381300 10:75882814-75882836 CCTCCACAGCCACCATCAGGAGG - Intronic
1071131412 10:82397911-82397933 CCCCCAAAGCCAGCAGCAGGAGG - Intronic
1074309965 10:112313640-112313662 CCCTCATCACCACCACCACCCGG + Intergenic
1075634302 10:124019857-124019879 CCCCCATCTCCCACACCAGGCGG + Intronic
1077058200 11:606152-606174 CCCCCAACTCCACCAACAGGTGG - Intronic
1078262892 11:9727627-9727649 CTCCAGTAACCACCACCATGTGG + Intronic
1078345049 11:10540856-10540878 CCCTCAGAACCACCCCGAGGCGG + Intronic
1083164278 11:60873943-60873965 AACCCATAACCACCACCAGGAGG + Intronic
1089073881 11:115721618-115721640 CCCCCAGCAGCCCCACCAGGGGG - Intergenic
1089590935 11:119540377-119540399 CTCCAACAACCTCCACCAGGTGG + Intergenic
1090164787 11:124535530-124535552 CCCCCATCACCACCACTAAATGG + Intergenic
1090255865 11:125283759-125283781 CCCCACTCCCCACCACCAGGAGG - Intronic
1092076726 12:5680128-5680150 CCACCATAACCACCACCAACAGG - Intronic
1092373215 12:7934332-7934354 CCCCCTCCACCACCACCAGTGGG - Intronic
1095639896 12:44475883-44475905 CCAGCATATCCACCACCAGCTGG + Intergenic
1096500666 12:52062272-52062294 CCTCCATAACCAAGACCAGGTGG - Intergenic
1099763807 12:86956132-86956154 CCCACATCACCCCCACCAGCAGG + Intergenic
1100380236 12:94054949-94054971 CCACCATCACCACCACCAGAGGG + Intergenic
1101809988 12:108099273-108099295 CCCTCATCTCCACCAGCAGGAGG + Intergenic
1102888203 12:116537499-116537521 CGCACATAAATACCACCAGGGGG - Intergenic
1103923555 12:124411755-124411777 GCCCCATCACCACCACCCTGAGG - Intronic
1104831261 12:131753342-131753364 CCTCCACAACCACCACCACAAGG + Exonic
1106103535 13:26714621-26714643 ACCCCATATCCACCACCCCGAGG + Intergenic
1106254924 13:28013560-28013582 CCCCCATCAACACCACCACCTGG - Intronic
1106397741 13:29397424-29397446 CCCCCATAACCAGTACCACTTGG + Intronic
1106403018 13:29447732-29447754 TCCCCACAACCACCACCACCTGG - Intronic
1107644229 13:42477553-42477575 TCCCCATCACCATCAGCAGGTGG - Intergenic
1107959360 13:45544724-45544746 TCCCCATACCCTCCACCAGGTGG - Intronic
1108585220 13:51865205-51865227 CCCTCACAAACACCACCATGTGG + Intronic
1110764641 13:79268697-79268719 CCCCCATCACCTCCACCACCAGG - Intergenic
1113500412 13:110769513-110769535 CCCAAATATCCAACACCAGGTGG - Intergenic
1113707113 13:112442100-112442122 CCCACATAACCACCTACAGTGGG + Intergenic
1114343732 14:21772949-21772971 CCACCGTCACCACCACCTGGAGG + Intergenic
1114477742 14:23009634-23009656 CCCCCAGAACCAAAACCAAGTGG - Intronic
1114485321 14:23058212-23058234 CTCCCACAACTACCACCAGGGGG - Intergenic
1117620442 14:57580806-57580828 CCCCCATTCCCCCCACCAGATGG - Intronic
1121299863 14:92861750-92861772 CCCCCACGAGCACCACCAGCTGG + Intergenic
1122722599 14:103730582-103730604 CCCCCCAAGCCACCACAAGGGGG - Intronic
1122856363 14:104562105-104562127 GCCCCAGAACCACAACGAGGAGG + Intronic
1124400373 15:29342560-29342582 CCCCCCCAACCAGCCCCAGGAGG - Intronic
1125507017 15:40272859-40272881 CCCGCATGATCACCACCTGGGGG - Exonic
1125929896 15:43593160-43593182 CACCCAGCACCACCAACAGGTGG + Exonic
1125943064 15:43692992-43693014 CACCCAGCACCACCAACAGGTGG + Intronic
1129501175 15:76038847-76038869 CCCCTATAGCCACCACCAGTGGG - Intronic
1129724989 15:77897154-77897176 CCCCCTTGGCCACCACCAGTGGG - Intergenic
1131123418 15:89837689-89837711 CACCCATCACCACCTCCTGGAGG + Exonic
1132871505 16:2117592-2117614 CCGCCTTCTCCACCACCAGGCGG + Exonic
1134396836 16:13873097-13873119 CCACCATCACCACCACCACTAGG - Intergenic
1134521022 16:14919303-14919325 CCGCCTTCTCCACCACCAGGCGG - Intronic
1134550550 16:15136670-15136692 CCGCCTTCTCCACCACCAGGCGG + Intronic
1134708698 16:16317954-16317976 CCGCCTTCTCCACCACCAGGCGG - Intergenic
1134715911 16:16357987-16358009 CCGCCTTCTCCACCACCAGGCGG - Intergenic
1134950907 16:18350691-18350713 CCGCCTTCTCCACCACCAGGCGG + Intergenic
1134958845 16:18394172-18394194 CCGCCTTCTCCACCACCAGGCGG + Intergenic
1136114651 16:28087198-28087220 CACCCACAACCACCCCCTGGGGG - Intergenic
1139408606 16:66740129-66740151 CCCCTATAGCCACCAGAAGGTGG - Intronic
1141938111 16:87255367-87255389 CCCCCAAATCCAGCTCCAGGAGG - Intronic
1141946753 16:87315931-87315953 CCCCCATCCCCACCACCCGTGGG - Intronic
1142005466 16:87687729-87687751 CTCCCAGCACCACCAGCAGGAGG - Intronic
1142709665 17:1716126-1716148 CCCCCACACCCAGCACCAGGTGG - Intergenic
1143593955 17:7903043-7903065 CCCCCATAATGACATCCAGGTGG + Exonic
1143609046 17:8007091-8007113 GCCCCATCCCAACCACCAGGAGG - Exonic
1144068460 17:11645512-11645534 TCACCATAGCCACCACCAGCTGG + Intronic
1146555924 17:33823952-33823974 CCCCCATAACCAGCTGCAGGGGG + Intronic
1147195643 17:38764886-38764908 CCCCCATCACAATCACCTGGAGG + Intergenic
1148556793 17:48583336-48583358 CCCCCATCACCCACACAAGGAGG + Intronic
1148856476 17:50581651-50581673 ACCCCTTAACCACCAGCTGGAGG + Intronic
1151505012 17:74521949-74521971 CCTCAAGAACCACCTCCAGGTGG - Exonic
1151516191 17:74597622-74597644 CTCCCATAATCCCCACCAGGAGG - Intergenic
1151911532 17:77086666-77086688 CACCAAGAGCCACCACCAGGGGG + Intergenic
1152352435 17:79791181-79791203 CACCCCTAACGCCCACCAGGAGG - Intergenic
1152735383 17:81994630-81994652 GCCCCACAACCACCAAAAGGAGG - Intronic
1152778465 17:82216082-82216104 CCCCTATATCCACCATCATGCGG + Intergenic
1153746507 18:8185335-8185357 CCCCCAGGAGCCCCACCAGGAGG + Intronic
1155919320 18:31587122-31587144 CTCCCCTAACCCCCACCATGAGG + Intergenic
1156401165 18:36741852-36741874 CCCCCAAACCCACCACCATCTGG - Intronic
1159017160 18:63110609-63110631 TCCCCACCACCACCACCAGCTGG - Intergenic
1160147768 18:76378792-76378814 CCCCCAGAACCACCCCCGGAGGG - Intronic
1161008961 19:1950853-1950875 ACCCCATAACCCCCACCTGGAGG - Intronic
1163669302 19:18618084-18618106 CCACAATAACCATGACCAGGAGG - Intronic
1163793434 19:19321452-19321474 TCCCCATCGCCACCAACAGGTGG - Intronic
1165951101 19:39474303-39474325 CCCCCAGAGCTACCACCAGGTGG + Exonic
1166739147 19:45103704-45103726 CCTCCATCACCACCACCAGGAGG - Intronic
1167374417 19:49103419-49103441 ACCCCACACCCACCACCACGGGG - Intronic
1168245900 19:55113114-55113136 CCCCCGTCACCACCCACAGGTGG + Intronic
1168282337 19:55312223-55312245 CCCCTAGAACCACCCCCAGTTGG - Exonic
925304430 2:2838378-2838400 CCTCCAGCACAACCACCAGGTGG + Intergenic
928065064 2:28155790-28155812 TCCCCATACCAACCACCAGATGG + Intronic
928248121 2:29649705-29649727 GCACCATACCAACCACCAGGAGG - Intronic
929084987 2:38159282-38159304 TCCACATAACCATCTCCAGGAGG - Intergenic
929821879 2:45280817-45280839 CCACCACCACCACCACCAGGAGG + Intergenic
939033998 2:137109546-137109568 CTCCCATCACCACCCCCAGATGG - Intronic
940803137 2:158154809-158154831 CCCCTATGACCACCACCACTGGG - Intergenic
941917111 2:170820162-170820184 CCCCCACCCCCACCCCCAGGCGG - Intronic
942099696 2:172567873-172567895 CCCCTATCACCACCCCCAGTGGG + Intronic
946230719 2:218289730-218289752 CCCCAAGAACCTACACCAGGGGG + Intronic
946249611 2:218404558-218404580 CCCCCACCAGCCCCACCAGGCGG + Exonic
946303614 2:218842398-218842420 CCCCCATAAACTCAACCAAGTGG - Intergenic
946394670 2:219437152-219437174 CCCCCAGAACCAAAACCAGGAGG - Intronic
947736682 2:232458864-232458886 CCCCGATTACCAGCAGCAGGCGG + Exonic
948684958 2:239664539-239664561 CCCCCATCACACTCACCAGGAGG - Intergenic
949026601 2:241769216-241769238 CCCCGAGGACCTCCACCAGGAGG - Intergenic
1171339128 20:24413231-24413253 ACCCCATCACCATCCCCAGGAGG - Intergenic
1171988756 20:31679251-31679273 CCCAGAGCACCACCACCAGGAGG + Intronic
1173226861 20:41167233-41167255 CCTCCATACCATCCACCAGGCGG - Intronic
1173793435 20:45842486-45842508 TCCCCACTACCACCACCAAGGGG + Intronic
1173888683 20:46485156-46485178 CCCCTCCAACCCCCACCAGGAGG + Intergenic
1174054418 20:47788207-47788229 GCCCCAGAAGCACCACCAAGGGG - Intergenic
1174970497 20:55269994-55270016 CACCCAGCACCACCACCAGGAGG + Intergenic
1175960628 20:62634658-62634680 CCCCTACTACCACCAGCAGGAGG - Intergenic
1179261773 21:39764144-39764166 CCTCCATAAGCAGGACCAGGAGG - Intronic
1179644242 21:42765924-42765946 CCTCCATAACCAGGACAAGGTGG + Intronic
1179879925 21:44289224-44289246 CCCCCATAATGACCAGCAGCTGG - Intronic
1179943682 21:44655876-44655898 CACCCATATCCACCACCAGCAGG - Intronic
1179946966 21:44685161-44685183 CACCCATATCCACCACCAGCAGG + Intronic
1181444663 22:22959747-22959769 CCCCCGTCTCCACCCCCAGGAGG - Intergenic
1182099083 22:27645355-27645377 CCACCATCACCACCACCACCAGG + Intergenic
1183408802 22:37643079-37643101 CCCCCATGCCCATCCCCAGGAGG + Exonic
1183574065 22:38675845-38675867 CCCCCATGACCAGCACCATTAGG + Intergenic
1184282659 22:43447072-43447094 TCCGCAGAACCACCAGCAGGGGG - Intronic
1184881761 22:47309878-47309900 CCCAAATAACCACCAACAGGTGG - Intergenic
1184985538 22:48130838-48130860 CCCTCCTCCCCACCACCAGGAGG + Intergenic
1185206561 22:49542091-49542113 TCCCCATGACTGCCACCAGGAGG + Intronic
950114615 3:10442605-10442627 CCCCCATCACCACTACCATGGGG - Intronic
951436986 3:22676467-22676489 TCCCCATAACCACCACAGGCTGG + Intergenic
953039344 3:39241122-39241144 CCACCACCACCACCACCAGTAGG + Intergenic
954384855 3:50238612-50238634 CCCCAACAAGAACCACCAGGAGG - Intronic
954541119 3:51393391-51393413 CCACCACCACCACCACCACGAGG + Exonic
954954169 3:54504458-54504480 CCCTCAAAACCACCCCCAGGAGG - Intronic
955330266 3:58041527-58041549 CCACCACCACCACCACCAGTGGG + Intronic
955830133 3:62992820-62992842 GCCCCATTACCACCACTGGGTGG + Intergenic
961650319 3:128413796-128413818 CCCACATAGCCACCACCTGGCGG + Intergenic
962509481 3:136084338-136084360 CCCACAGAACCAACACCACGTGG - Intronic
962636623 3:137338482-137338504 CCCCCAGGACCAACACCACGTGG - Intergenic
963056736 3:141192418-141192440 TCCCCAAATCTACCACCAGGGGG - Intergenic
964801468 3:160564339-160564361 CCCCCACTACCACCACCAGCAGG + Intronic
965035026 3:163426619-163426641 CCCCTATAGCCACCACCACTGGG - Intergenic
965239843 3:166181969-166181991 CCCCCATCACCAACACCAACAGG + Intergenic
967521760 3:190440364-190440386 CCACCAAAACCAGCAGCAGGAGG + Exonic
971149693 4:24018794-24018816 CCCCCATTTCCCCCACCTGGGGG + Intergenic
971296043 4:25392927-25392949 GCCCCGTTACCACCACCATGTGG - Intronic
972007435 4:34128244-34128266 CTCCCATTACCACCACCACTGGG - Intergenic
978116275 4:105023230-105023252 CCCCTATAAGCACCACCACAAGG - Intergenic
978446782 4:108787786-108787808 CCCCCAACACCCCCACCAGGAGG + Intergenic
980682902 4:136187263-136187285 TCCCCATAACCACCACAACTGGG - Intergenic
981558501 4:146022464-146022486 CCCCCATGACAACCACCACTGGG + Intergenic
985607698 5:867181-867203 CCCACATACCCAACACCATGTGG - Intronic
992285062 5:75226378-75226400 CCCCTATAGCCACCACCACTGGG - Intronic
992556930 5:77913063-77913085 CTCCCATTTCCACCACCGGGAGG - Intergenic
994120982 5:96112434-96112456 CTCCCATATCCTCCACTAGGAGG + Intergenic
997088328 5:130827051-130827073 CACCCAGAACCAACACCACGTGG + Intergenic
997391554 5:133521146-133521168 CCCCCATCCCCAGCAGCAGGGGG + Intronic
997698146 5:135877813-135877835 TCCCCATGGCCACCCCCAGGTGG - Intronic
997759308 5:136429588-136429610 CCACCATATCCACCACCACCAGG - Intergenic
1001084869 5:168693238-168693260 GACCCATAACCTCCCCCAGGAGG + Intronic
1001925213 5:175631160-175631182 CCCCCATCACCTCCAGCAGTGGG - Intergenic
1002371943 5:178761916-178761938 CCACCACAACTACCACCAGTTGG + Intergenic
1003351402 6:5320881-5320903 CCCCCACAACCACCACGTGAGGG - Intronic
1003921306 6:10835891-10835913 CCCCCATCACCACCGCCCTGGGG + Intronic
1007362488 6:41369071-41369093 CCTTCATAACCACCAGGAGGCGG + Intergenic
1012910442 6:105111976-105111998 ACACCATAATCACCACCATGGGG + Intronic
1013423067 6:109983841-109983863 CCCCCAGAGCCAGCACCAGCAGG + Intergenic
1015280827 6:131432279-131432301 TCCTTATAACCACCACCAGCTGG - Intergenic
1018062784 6:160103647-160103669 CCCCCATCTGCACCACCAGGGGG - Intronic
1018704062 6:166450302-166450324 CCACCATAGGGACCACCAGGGGG + Intronic
1019770425 7:2880847-2880869 CCCCCATAAGCATCAACAGAAGG - Intergenic
1019882452 7:3874900-3874922 CCCCCACATCCAGCACCAAGTGG + Intronic
1022472760 7:30691840-30691862 CACCCATCACCACCACCACTAGG - Intronic
1023275236 7:38512026-38512048 TCCCAATAACCATCACCTGGAGG - Intronic
1026612383 7:71871630-71871652 CCCCCACTCCCACCACCAGATGG + Intronic
1029339883 7:99934142-99934164 CCACCACCACCACCACCACGAGG + Intergenic
1030672208 7:112350140-112350162 CCCTCACTACCACCACCAAGGGG + Intergenic
1031076809 7:117221039-117221061 CCCCCAGCACCCCCAGCAGGTGG + Intronic
1031278417 7:119762927-119762949 CCCCATTAACCACCATCAGTTGG + Intergenic
1032541900 7:132710133-132710155 CCAGAATCACCACCACCAGGGGG + Intronic
1033327352 7:140390634-140390656 CCTCCATCCCCACCGCCAGGTGG + Intronic
1034420918 7:150990288-150990310 GCCCAAAAACCACGACCAGGAGG + Intergenic
1036082087 8:5568127-5568149 ATCCCATAGCCACCACCATGAGG + Intergenic
1037676552 8:21056000-21056022 CCATCATAACCATCACCACGTGG + Intergenic
1039556921 8:38483204-38483226 CCCCCTTAGCCAGGACCAGGGGG - Intergenic
1041606916 8:59792778-59792800 CCCCTATAGCCACCACAAGTGGG - Intergenic
1041762253 8:61379387-61379409 CCCCCATCTCCACCACCAAATGG + Intronic
1041948402 8:63473072-63473094 ACCCCATATCCAACACCTGGAGG - Intergenic
1042809967 8:72813751-72813773 CCCCTTTAACCACCCCCAAGGGG + Intronic
1042877813 8:73455815-73455837 CCCCCTTGACCACGGCCAGGTGG - Intronic
1047460841 8:125063873-125063895 AGCACATAAGCACCACCAGGAGG + Intronic
1047872760 8:129103404-129103426 CTCCCATAGCCTCCATCAGGAGG - Intergenic
1049080301 8:140437819-140437841 CTCCCAGGACCACCTCCAGGAGG + Intronic
1049664475 8:143836877-143836899 CCCCCATGACCCCCACAAGGGGG + Intronic
1057031075 9:91775605-91775627 CCACCATACCCACCACCAGGGGG + Intronic
1058004057 9:99896381-99896403 CTCCCGTAACCACCACCACTGGG - Intergenic
1061296879 9:129681694-129681716 CCCCCAAAACCAGAACCAGATGG + Intronic
1061545391 9:131301476-131301498 CACCAACCACCACCACCAGGAGG + Intronic
1185985488 X:4827898-4827920 CCCCCAAAACCACCCCCAACAGG - Intergenic
1187715925 X:22102594-22102616 ACCCCATCACCACCACAAGGAGG + Intronic
1190084236 X:47381300-47381322 CCCCCTCAAACCCCACCAGGAGG - Intronic
1190893776 X:54596469-54596491 CCCCTATAGCCACCACCAGTAGG + Intergenic
1190968301 X:55323546-55323568 CCCCCATAACCAGCACATGATGG - Intergenic
1193070751 X:77303452-77303474 CACCCACAAACACCAACAGGAGG + Intergenic
1193555774 X:82951957-82951979 ACCCCATAACCACCATCAACTGG + Intergenic
1194340560 X:92700347-92700369 CCCCCATGGCCACCACCACTGGG + Intergenic
1195455410 X:105063920-105063942 ACCCCATCCCCACCTCCAGGTGG - Intronic
1199089704 X:143677315-143677337 CTACCATAACCACCACCACTTGG + Intergenic
1200125704 X:153813415-153813437 CCTTCAGAACCACCACCAGGAGG + Intronic
1200648915 Y:5817085-5817107 CCCCCATGGCCACCACCACTGGG + Intergenic