ID: 904595944

View in Genome Browser
Species Human (GRCh38)
Location 1:31645309-31645331
Sequence CGGTCGGTTCCCCGTTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 11}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904595944_904595956 29 Left 904595944 1:31645309-31645331 CCCTGACAACGGGGAACCGACCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 904595956 1:31645361-31645383 GAATTACTCCTCTAATGTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 107
904595944_904595952 4 Left 904595944 1:31645309-31645331 CCCTGACAACGGGGAACCGACCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 904595952 1:31645336-31645358 TTCCCGGTAGGGAGAGGCGATGG 0: 1
1: 0
2: 0
3: 11
4: 93
904595944_904595951 -2 Left 904595944 1:31645309-31645331 CCCTGACAACGGGGAACCGACCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 904595951 1:31645330-31645352 CGACTCTTCCCGGTAGGGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 52
904595944_904595949 -7 Left 904595944 1:31645309-31645331 CCCTGACAACGGGGAACCGACCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 904595949 1:31645325-31645347 CCGACCGACTCTTCCCGGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
904595944_904595955 7 Left 904595944 1:31645309-31645331 CCCTGACAACGGGGAACCGACCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 904595955 1:31645339-31645361 CCGGTAGGGAGAGGCGATGGCGG 0: 1
1: 0
2: 0
3: 11
4: 180
904595944_904595947 -8 Left 904595944 1:31645309-31645331 CCCTGACAACGGGGAACCGACCG 0: 1
1: 0
2: 0
3: 2
4: 11
Right 904595947 1:31645324-31645346 ACCGACCGACTCTTCCCGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904595944 Original CRISPR CGGTCGGTTCCCCGTTGTCA GGG (reversed) Intergenic
904595944 1:31645309-31645331 CGGTCGGTTCCCCGTTGTCAGGG - Intergenic
1071397624 10:85238882-85238904 CGGTTGGATCCCCGCTGTCCGGG - Intergenic
1076885136 10:133258743-133258765 CCGCCGCTTCCCCGCTGTCAGGG - Intergenic
1078023544 11:7673815-7673837 CGGCCGGTTCCCCGTCGGCCAGG - Exonic
1085284791 11:75352384-75352406 CGCTCAGTTCCCCAGTGTCAAGG - Intergenic
1090355666 11:126138938-126138960 AGGTCGGTTCCCCGGGGTCATGG - Intergenic
1158422138 18:57304483-57304505 CTGTTGGATCCCCATTGTCATGG - Intergenic
1161762845 19:6187228-6187250 CTGGGGGTTCCACGTTGTCATGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
999241528 5:150130606-150130628 CTGTCTGTTCCCCACTGTCAGGG + Exonic
1033125027 7:138699876-138699898 CGGGTGGGTCCCCGGTGTCAGGG + Intronic
1034104567 7:148479315-148479337 AGGCCGGCTCCCAGTTGTCAAGG - Intergenic
1051656326 9:19385407-19385429 CTGTCGGTTGCCAGTTGTTATGG - Intergenic
1198438351 X:136638524-136638546 TGGTTGGTTCCCCGATGTCAGGG + Intergenic