ID: 904599034

View in Genome Browser
Species Human (GRCh38)
Location 1:31663856-31663878
Sequence GGCAAGCAGCATAGCGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904599030_904599034 -5 Left 904599030 1:31663838-31663860 CCAGAAAAGGCGGGGGGAGGCAA 0: 1
1: 0
2: 0
3: 12
4: 137
Right 904599034 1:31663856-31663878 GGCAAGCAGCATAGCGGGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904599034 Original CRISPR GGCAAGCAGCATAGCGGGGA AGG Intronic
900089101 1:911608-911630 GGCAGGCAGCAGAGTGGAGAAGG + Intergenic
900243096 1:1626066-1626088 GGGAAGCAGGATGGCAGGGAGGG + Intronic
900406909 1:2496753-2496775 GCCCAGCAGCATAGCAGGGATGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904599034 1:31663856-31663878 GGCAAGCAGCATAGCGGGGAAGG + Intronic
905174508 1:36127284-36127306 GGCAGGCAGCAGAAGGGGGAAGG - Intergenic
905435343 1:37951758-37951780 GGTAAGCAGCATATGAGGGAGGG - Intergenic
906227840 1:44136635-44136657 GGAAAGCTGCCCAGCGGGGATGG + Intergenic
906526353 1:46495405-46495427 GCTAAGCAGCTTAGCCGGGATGG - Intergenic
908782249 1:67701053-67701075 GGCAAGCAGGATAGGAGGGCGGG + Intergenic
912698213 1:111856846-111856868 GGCAAGCAGCTAAGCAGGGCAGG + Intronic
1064480683 10:15737541-15737563 GGCAAGAAGAAAAGAGGGGAAGG - Intergenic
1065241904 10:23714173-23714195 AACAAACAGGATAGCGGGGAAGG - Intronic
1067530263 10:47066063-47066085 GGCAAGGAGCAGGGTGGGGAAGG - Intergenic
1067571378 10:47373833-47373855 CGCAGGCAGCATGGCGAGGAAGG + Intronic
1067789900 10:49279947-49279969 GGCCAGGAGCATAGCAGAGAAGG + Intergenic
1072547944 10:96455019-96455041 GGCAAGCACCATATGGGGAAAGG - Intronic
1074662427 10:115676721-115676743 GGAAAGGAGCATAGAGTGGAGGG + Intronic
1077922097 11:6649310-6649332 GTCAGGCAGCAAAGCAGGGAAGG + Intronic
1078064039 11:8066303-8066325 GGCAGGCAGCATGGAGGTGAAGG + Intronic
1078520369 11:12058001-12058023 GACAACTAGGATAGCGGGGACGG - Intergenic
1078528918 11:12121353-12121375 GGGAGGCAGCAAAGCTGGGATGG + Intronic
1079138709 11:17793209-17793231 GGCAAACAGCAAAGAGGAGATGG + Intronic
1085645225 11:78218368-78218390 TGAAAGCAGCATACAGGGGAAGG - Exonic
1085810923 11:79680295-79680317 GGCAACCACCACAGCAGGGAAGG - Intergenic
1088990560 11:114949925-114949947 GGGATTCAGCATAACGGGGAGGG + Intergenic
1096590948 12:52659004-52659026 GGCAAGCACAAAAGAGGGGAGGG + Intergenic
1100407053 12:94280869-94280891 GGCAAGGAGCAGAGCAAGGAGGG + Intronic
1100447474 12:94675005-94675027 GCCGAGCAGGAGAGCGGGGAGGG + Intergenic
1103381399 12:120496600-120496622 GGAAAGCAGGATCGGGGGGAAGG - Intronic
1103731908 12:123033325-123033347 GGCCAGCAGGAGAGCTGGGATGG + Intronic
1103831773 12:123785786-123785808 GGCACTCATCATGGCGGGGATGG - Exonic
1103995714 12:124828723-124828745 TGCAAGGAGCCCAGCGGGGATGG - Intronic
1104737046 12:131141662-131141684 GGCAAGCAGCATGCCTGGGGAGG + Intergenic
1110343629 13:74420573-74420595 GTCAAGCAGGATAGTGGGAAAGG + Intergenic
1117191015 14:53291964-53291986 GGTCAGCAGCATAGCAGGGTGGG - Intergenic
1122256903 14:100485060-100485082 GGCAAGGAGCCTAGTGGGGCTGG - Intronic
1123690187 15:22832234-22832256 GGCAAGCAGGACAGCGGTGGTGG + Intergenic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1129410475 15:75347999-75348021 GGCAAGTGGCAAAGCAGGGAGGG + Intronic
1135913184 16:26579466-26579488 GGGGAGTAGCATAGCTGGGAGGG + Intergenic
1136725794 16:32356308-32356330 GGAAAGGAGCATAGCGAGGTTGG - Intergenic
1136844127 16:33562359-33562381 GGAAAGGAGCATAGCGAGGTTGG - Intergenic
1139590168 16:67928937-67928959 GGGAAGCAGCACAGGGTGGACGG - Exonic
1141444427 16:84048986-84049008 GGCAGGCAGCCTGGCGGTGAGGG + Intergenic
1141677250 16:85524302-85524324 GGCAAGCAGCAGGACTGGGATGG - Intergenic
1203000636 16_KI270728v1_random:161446-161468 GGAAAGGAGCATAGCGAGGTTGG + Intergenic
1203132239 16_KI270728v1_random:1697851-1697873 GGAAAGGAGCATAGCGAGGTTGG + Intergenic
1203154292 16_KI270728v1_random:1862658-1862680 GGAAAGGAGCATAGCGAGGTTGG - Intergenic
1147440714 17:40445640-40445662 GGCACCCAGCATATCTGGGAAGG + Intronic
1148128097 17:45247140-45247162 TGCAAGCAGCATTTGGGGGAAGG - Exonic
1148633843 17:49132484-49132506 GGGACACAGCATAGCGAGGAAGG + Intronic
1151418070 17:73979722-73979744 GGCAGGAAGCCAAGCGGGGACGG + Intergenic
1153915856 18:9743594-9743616 GGCAGGAAGCATATCCGGGAGGG - Intronic
1155456901 18:26026635-26026657 GGCAAGCAGGAGGGTGGGGAAGG + Intronic
1160362267 18:78293923-78293945 GCCCAGCAGCAAACCGGGGAGGG - Intergenic
1160585647 18:79911933-79911955 GGACAGCAGCAGAGAGGGGACGG + Intronic
1163814823 19:19458239-19458261 GCCAAGCAGCTGAGCAGGGAGGG - Intronic
1165346767 19:35253526-35253548 GGCATGGGGCAGAGCGGGGAAGG + Intronic
1166534520 19:43563971-43563993 GGAAATCAGCAGAGCTGGGAAGG - Intronic
1166896156 19:46022995-46023017 GGCAAGCAGCATAGAGCGGCGGG + Exonic
1167565320 19:50252433-50252455 GGCAGGGGGCATAGAGGGGAAGG + Intronic
1167792156 19:51689424-51689446 GGGAAGGAGGATGGCGGGGACGG + Intergenic
926172432 2:10560767-10560789 GGCAGGCAGGAGAGCTGGGAGGG - Intergenic
928142957 2:28746351-28746373 GGCTGGCAGCATAGAGGGCAAGG - Intergenic
929189243 2:39124137-39124159 GGCAAGCAGTACAGGGGTGATGG - Intronic
931366019 2:61619711-61619733 GACAAGAAGCATAACGGGGCAGG + Intergenic
932212384 2:69943431-69943453 GGAAAGGAGCATTGCTGGGAAGG + Intergenic
933708663 2:85309377-85309399 GGCATGGAGCGTGGCGGGGAAGG - Exonic
934320090 2:91964262-91964284 GGAAAGGAGCATAGCGAGGTTGG + Intergenic
940186093 2:150986155-150986177 GGGATGCAGCATAGGGGGCAGGG - Intergenic
948762885 2:240203546-240203568 GGGAAGGAGCGTAGAGGGGAGGG + Intergenic
948980850 2:241494029-241494051 GGCCAGCAGCTCAGCCGGGAGGG + Exonic
1170677456 20:18495689-18495711 GGCAAGCAGCTTGGGGAGGAGGG - Intronic
1172779607 20:37428255-37428277 TGCCAGCAGCAAAGTGGGGATGG - Intergenic
1172941585 20:38658135-38658157 GGCAGGCAGAATAGCTGGGAGGG - Intergenic
1180076858 21:45467468-45467490 GGGAATCAGCATGGGGGGGATGG + Intronic
1180308343 22:11148316-11148338 GGAAAGGAGCATAGCGAGGTTGG + Intergenic
1180546819 22:16510129-16510151 GGAAAGGAGCATAGCGAGGTTGG + Intergenic
1181083182 22:20427289-20427311 GGCAGGCAGCATGGAGAGGAAGG - Intronic
1181677613 22:24466859-24466881 GACAAGCAGCAGAGAGGGGGTGG + Intergenic
1185222902 22:49637882-49637904 GCCAAGAAGCAGAGCGTGGATGG + Intronic
955721528 3:61886546-61886568 GGCAAGGGGCAGGGCGGGGAAGG - Intronic
956776373 3:72568630-72568652 GACAAGCAGCAGAGGGAGGAAGG - Intergenic
959268200 3:104170708-104170730 GGCAAGGAGAATAGCTGGCAGGG + Intergenic
961178020 3:124852072-124852094 GGAAAGCAGCGTGGCCGGGAAGG - Intronic
961370213 3:126424167-126424189 GTTCAGCAGCATAACGGGGACGG + Intronic
962102034 3:132352773-132352795 GGCAAGAAGCATAGGGAGGAAGG - Exonic
963019644 3:140860520-140860542 GGCAGTCATCATTGCGGGGAGGG - Intergenic
964769838 3:160212616-160212638 GGCAAGGAGCAGAGCAGGAAGGG - Intergenic
965692977 3:171377376-171377398 GTGAAGCAGCTGAGCGGGGAGGG - Intronic
966167870 3:177041436-177041458 GGGAAGCAGGATGGGGGGGAGGG - Intronic
969637244 4:8376580-8376602 GGCATGAAGCACAGCGGGAAAGG - Intronic
970365060 4:15350117-15350139 GGCAAGCAGGAAAGAAGGGAGGG + Intronic
972573755 4:40333418-40333440 GCCCAGCAGCAGAGTGGGGATGG - Intergenic
980566597 4:134550825-134550847 GGCAAGATGCACAGTGGGGAAGG - Intergenic
984870898 4:184324149-184324171 GGCCAGCAGAATGGGGGGGAGGG - Intergenic
985554963 5:554128-554150 GGCAAGCGGCATAGGGGCCAGGG - Intergenic
986240330 5:5954831-5954853 GGCAAGGAGGAAAGGGGGGAAGG - Intergenic
986575177 5:9204974-9204996 GGCAGGGAGGATAGAGGGGATGG - Intronic
992408664 5:76483816-76483838 GCCAAGCAGAATTGGGGGGATGG + Intronic
996586181 5:125090100-125090122 GGCAGGCAGCATAGACGGCATGG - Intergenic
1000194386 5:158943734-158943756 GGGAAACAGAATAGTGGGGAGGG + Intronic
1003032993 6:2618913-2618935 GGCTAGGAGCACAGTGGGGAGGG - Intergenic
1003472691 6:6451926-6451948 GGGAGGCAGGATAGCAGGGAGGG - Intergenic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1004246447 6:13982043-13982065 GGCAGGCAGCGTAGAGGGAAGGG - Intergenic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1006799136 6:36748348-36748370 GGCAAGCAGCAGAGCCAGGGTGG - Intronic
1012724928 6:102798904-102798926 GGCAAGCAGCAGAGAGGAGCAGG + Intergenic
1019328575 7:451852-451874 GCCCAGCAGCCCAGCGGGGAAGG - Intergenic
1022414846 7:30169089-30169111 GGCAAGCAGCATACCCGGCTCGG - Intergenic
1024518788 7:50284591-50284613 GGCCAGCAGCATAGTGGGAATGG - Intergenic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1029704077 7:102266624-102266646 GGCAAGAAGCTTAGCAGGGAGGG + Intronic
1036489319 8:9210376-9210398 GGCAAGCAGCATGTCGGTGCTGG - Intergenic
1036545509 8:9765797-9765819 GGTAAGCAGCGTGGCAGGGACGG + Exonic
1037637276 8:20711264-20711286 TGGAAGCAGCATTGTGGGGAAGG - Intergenic
1037910640 8:22741758-22741780 GGCAGGCAGGAGAGCGGGGTTGG + Intronic
1038356376 8:26832776-26832798 GGCAAGCAGGATGGGGTGGAAGG + Intronic
1039966975 8:42290702-42290724 GGCAGGGAGCATAGCAGAGAGGG + Intronic
1040543702 8:48380827-48380849 GGCAACCAGCAGAACGGAGAGGG + Intergenic
1044941230 8:97345971-97345993 GGCCAGCAGCACAGCTGGGTGGG - Intergenic
1045051002 8:98325519-98325541 GCAAAGCAGCAAAACGGGGAGGG + Intergenic
1049301952 8:141875419-141875441 GGCACGAGGCAGAGCGGGGAAGG + Intergenic
1049428004 8:142545798-142545820 GGCAGGGACAATAGCGGGGAAGG + Intergenic
1056803775 9:89712610-89712632 AGCAACCAGCAAAGAGGGGATGG - Intergenic
1057312207 9:93949554-93949576 GGCAAGGAGCACAGAGGTGAAGG + Intergenic
1057505050 9:95626879-95626901 GGAAAGCAACAGAGAGGGGAAGG - Intergenic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1061618071 9:131793091-131793113 AGCAACCAGCATAGCCTGGAAGG - Intergenic
1062449592 9:136609929-136609951 GGGAGGCAGCATCGCAGGGAGGG - Intergenic
1193020931 X:76792056-76792078 GGGAAGCATCAGAGGGGGGAGGG + Intergenic
1193814069 X:86084632-86084654 GGCAAGCAGCACGGAGCGGAAGG - Intergenic
1200960534 Y:8992009-8992031 GGCAAACAGCAAAACAGGGATGG + Intergenic
1201187613 Y:11419370-11419392 GGAAAGGAGCATAGCGAGGTTGG + Intergenic