ID: 904601318

View in Genome Browser
Species Human (GRCh38)
Location 1:31674156-31674178
Sequence GACCCCGATGGGCCTTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904601318_904601331 27 Left 904601318 1:31674156-31674178 CCTGACCAAGGCCCATCGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 904601331 1:31674206-31674228 AGTGTCAGAAGAGGGTGGCCAGG 0: 1
1: 0
2: 4
3: 22
4: 268
904601318_904601328 19 Left 904601318 1:31674156-31674178 CCTGACCAAGGCCCATCGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 904601328 1:31674198-31674220 AATTAGCCAGTGTCAGAAGAGGG 0: 1
1: 0
2: 1
3: 22
4: 240
904601318_904601327 18 Left 904601318 1:31674156-31674178 CCTGACCAAGGCCCATCGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 904601327 1:31674197-31674219 TAATTAGCCAGTGTCAGAAGAGG 0: 1
1: 0
2: 1
3: 16
4: 176
904601318_904601329 22 Left 904601318 1:31674156-31674178 CCTGACCAAGGCCCATCGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 904601329 1:31674201-31674223 TAGCCAGTGTCAGAAGAGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 227
904601318_904601324 -9 Left 904601318 1:31674156-31674178 CCTGACCAAGGCCCATCGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 904601324 1:31674170-31674192 ATCGGGGTCATGGGATGTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 57
904601318_904601325 -8 Left 904601318 1:31674156-31674178 CCTGACCAAGGCCCATCGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 904601325 1:31674171-31674193 TCGGGGTCATGGGATGTCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904601318 Original CRISPR GACCCCGATGGGCCTTGGTC AGG (reversed) Intronic
900121229 1:1049478-1049500 GACCCCAAAGGGCCGGGGTCGGG - Intronic
900122676 1:1055543-1055565 CACCCAGATCGGCCCTGGTCTGG - Exonic
900363363 1:2300502-2300524 GGCCCCCAGGGGCCTTGGTAGGG + Intronic
900460636 1:2800834-2800856 GACCCCGACGGGCCCATGTCTGG + Intronic
900592195 1:3465110-3465132 GAGCCCCATGGGCCTGGGCCTGG - Intronic
900960934 1:5919580-5919602 GACTCAGATGGGGCTTGTTCAGG - Intronic
902269136 1:15290432-15290454 GACTCCGAAGGGCCTGGGGCTGG - Intronic
903285239 1:22272844-22272866 GACCCTGCTGGGCCTGGGTGAGG + Intergenic
904601318 1:31674156-31674178 GACCCCGATGGGCCTTGGTCAGG - Intronic
914242748 1:145863125-145863147 AAACCCGATGGGCCATGATCAGG - Intergenic
1076248012 10:128962416-128962438 GACCCAGATGGGCCTGGCTGTGG - Intergenic
1076306114 10:129466904-129466926 GACCCGGATGGCCCTTCGGCCGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1084040455 11:66539613-66539635 GGCCCCGCTGGGCCCTCGTCTGG - Exonic
1084312505 11:68325118-68325140 TACCCAGAAGGGCCTTGGTCAGG - Intronic
1084670701 11:70605020-70605042 GGACCAGATGGGCCTTGGTCAGG + Intronic
1085272479 11:75278476-75278498 GACCCCTGTGGTCCTTGGGCTGG + Intronic
1092125743 12:6073947-6073969 GCCCCCGATGGGTCTTGGTAAGG - Intronic
1094820088 12:34217798-34217820 GGCTGCGGTGGGCCTTGGTCAGG + Intergenic
1096479164 12:51926489-51926511 GACCCAGCTTGGCCTGGGTCAGG + Intergenic
1106182901 13:27383557-27383579 CACCCCCATGGACCTTGGTGAGG + Intergenic
1113416385 13:110131646-110131668 GACACCGTTGTGCCTGGGTCCGG - Intergenic
1113492858 13:110706024-110706046 GGCCGCGCTGGGCCTTGGGCGGG - Exonic
1121010677 14:90518379-90518401 GTGCCCTGTGGGCCTTGGTCCGG - Intergenic
1122553152 14:102560970-102560992 GGCCCTGGTGGGCCTGGGTCTGG - Intergenic
1122769642 14:104092279-104092301 GAGCCCCGTGGGCCTTGGTGGGG + Intronic
1125956250 15:43792839-43792861 GGCCTCGATGGGCCGTTGTCGGG + Intronic
1127808242 15:62540741-62540763 GATCTCGAAGGGCCTTAGTCAGG + Intronic
1129078695 15:73020660-73020682 GACCCGGCTGGACCTTGATCTGG + Intergenic
1130649801 15:85756079-85756101 GAACCTGAGGGGCCTTGCTCTGG - Intergenic
1131118528 15:89808983-89809005 TTCCCCAAGGGGCCTTGGTCTGG + Intronic
1132110243 15:99097463-99097485 GACCCCGCTGTGTCTTGGGCAGG - Intergenic
1132660442 16:1058580-1058602 GACCCTGGTGGGCACTGGTCAGG - Intergenic
1139580816 16:67872818-67872840 GACTCCGATGGTCCTGGGACGGG - Intergenic
1150530730 17:65978416-65978438 GACCGAGCTGGGCCTTGCTCCGG - Intronic
1152640809 17:81448447-81448469 GTCCACCCTGGGCCTTGGTCCGG + Intronic
1152800864 17:82330092-82330114 GACCCCAGGGGGCCTGGGTCCGG + Intronic
1156006605 18:32449929-32449951 GACCCCTATGGACATTGGGCAGG + Intronic
1156274292 18:35567990-35568012 TACCCTGCTGGGCCTTGATCTGG - Intergenic
1157697986 18:49738920-49738942 GATCCAGATGGGCAGTGGTCTGG + Intergenic
1158653258 18:59306750-59306772 CTCCCCGTCGGGCCTTGGTCAGG + Intronic
1161455292 19:4366825-4366847 AACCTTGATGGGCCTGGGTCTGG - Intronic
1163785588 19:19273329-19273351 GACCCCGCTGCGCCCTGGGCAGG + Intronic
1166280170 19:41787210-41787232 GTCCCCGATGGTCCTTTGTGTGG + Intergenic
928215267 2:29356065-29356087 GACCTCGAGGGGCCTTGGGCAGG - Intronic
929667592 2:43845256-43845278 GACCCAGATGGGACATGGTGGGG + Intronic
940454006 2:153873125-153873147 GATCCCGAAGCGCCTTGGTTAGG + Intronic
942204940 2:173610798-173610820 AACCCAGTTGTGCCTTGGTCTGG - Intergenic
1172109606 20:32537220-32537242 CACCCCGCTGCGCCTTGGGCGGG - Intronic
1180082421 21:45493030-45493052 GGCCGCGAGGGGCCCTGGTCGGG + Intronic
1182119737 22:27779037-27779059 GACCCAGATGGGGCTGGTTCGGG - Intronic
1182121164 22:27787815-27787837 GACCCAGATGGGCCCTGGGTAGG - Intronic
1184235540 22:43181089-43181111 GACTCCAGTGGGCCTGGGTCAGG + Intronic
1184658213 22:45952694-45952716 GACCCTGATGGGACTTAGTGTGG + Intronic
1185025163 22:48404797-48404819 GTCCCCGGAGGGCCTGGGTCAGG - Intergenic
1185171910 22:49299209-49299231 CACCCCGCTTGGCCCTGGTCAGG - Intergenic
952191725 3:31029806-31029828 TTCCCTGATGGGCCTGGGTCTGG - Intergenic
956423057 3:69104546-69104568 GACACCGATGGGCATTGTCCTGG + Exonic
969050500 4:4369603-4369625 GACCCTGCCGGGCCTTGATCTGG - Intronic
978015428 4:103738995-103739017 GACACCAAAGGGCCTTGATCAGG + Intergenic
978245396 4:106565829-106565851 GGTCCCGTTGGGCCTTGGTCAGG - Intergenic
1002634877 5:180602308-180602330 GACTCCGAGGAGCCTGGGTCTGG - Exonic
1006716169 6:36122150-36122172 AAGCCCTATGGACCTTGGTCAGG - Intergenic
1007777941 6:44234228-44234250 GACCCAGCTGGGCCCTGGCCAGG + Intergenic
1016323141 6:142870110-142870132 GACCCAGGTGGGTCTTGGTGGGG - Intronic
1018679701 6:166253573-166253595 GACCCCGGAGGGCCTTTGCCTGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1029818786 7:103124786-103124808 GACCCCAGTCTGCCTTGGTCTGG - Intronic
1045501530 8:102747661-102747683 GACCCCCAGAGTCCTTGGTCAGG - Intergenic
1045651177 8:104342807-104342829 GACCAGGATGGGCCTGCGTCCGG + Intronic
1052852438 9:33386229-33386251 GACCCCGGTGGGGCTTAGTTGGG - Intronic
1053930530 9:43111091-43111113 GACCCCGGTGGGGCTTAGTTGGG - Intergenic
1059404576 9:114092045-114092067 GACCCAGATGGACCTGGGTGAGG - Intronic
1060411138 9:123401077-123401099 GATCCTAATGGGCCTTTGTCAGG - Intronic
1062117303 9:134816444-134816466 GACCCCCATGGGCCCTGGGCAGG + Intronic
1190334378 X:49253554-49253576 CACCCCGATTTTCCTTGGTCAGG + Intronic
1191250003 X:58255766-58255788 GACCCCCGTGGGCCTGGCTCAGG - Intergenic
1198420693 X:136468666-136468688 GTCCCTGCTGGGCCTTGATCTGG + Intergenic
1200144850 X:153921228-153921250 CCCCCCGATGGGGCTTGATCTGG - Intronic
1201766560 Y:17578429-17578451 GGCTGCGTTGGGCCTTGGTCAGG + Intergenic
1201834992 Y:18327555-18327577 GGCTGCGTTGGGCCTTGGTCAGG - Intergenic