ID: 904603008

View in Genome Browser
Species Human (GRCh38)
Location 1:31683966-31683988
Sequence CCTGGGGGCCCTTGAACTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2835
Summary {0: 1, 1: 0, 2: 4, 3: 117, 4: 2713}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904603001_904603008 -6 Left 904603001 1:31683949-31683971 CCTGCACGCCCTTCAGTCCTGGG 0: 1
1: 0
2: 1
3: 22
4: 221
Right 904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG 0: 1
1: 0
2: 4
3: 117
4: 2713
904602998_904603008 11 Left 904602998 1:31683932-31683954 CCCAAGACTCACACATACCTGCA 0: 1
1: 0
2: 2
3: 20
4: 302
Right 904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG 0: 1
1: 0
2: 4
3: 117
4: 2713
904602999_904603008 10 Left 904602999 1:31683933-31683955 CCAAGACTCACACATACCTGCAC 0: 1
1: 0
2: 4
3: 47
4: 395
Right 904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG 0: 1
1: 0
2: 4
3: 117
4: 2713
904602997_904603008 12 Left 904602997 1:31683931-31683953 CCCCAAGACTCACACATACCTGC 0: 1
1: 0
2: 4
3: 20
4: 245
Right 904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG 0: 1
1: 0
2: 4
3: 117
4: 2713
904602996_904603008 18 Left 904602996 1:31683925-31683947 CCAGGGCCCCAAGACTCACACAT 0: 1
1: 0
2: 4
3: 20
4: 228
Right 904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG 0: 1
1: 0
2: 4
3: 117
4: 2713
904602995_904603008 19 Left 904602995 1:31683924-31683946 CCCAGGGCCCCAAGACTCACACA 0: 1
1: 0
2: 5
3: 26
4: 223
Right 904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG 0: 1
1: 0
2: 4
3: 117
4: 2713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904603008 Original CRISPR CCTGGGGGCCCTTGAACTCC TGG Exonic
Too many off-targets to display for this crispr