ID: 904603062

View in Genome Browser
Species Human (GRCh38)
Location 1:31684135-31684157
Sequence CGGGGCCCTGCTCTCCTTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904603054_904603062 -4 Left 904603054 1:31684116-31684138 CCAGGTCGGCCCACGCCTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 184
904603049_904603062 23 Left 904603049 1:31684089-31684111 CCGGAGGGCAGGCAACTCACGGG 0: 1
1: 0
2: 0
3: 12
4: 90
Right 904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904603062 Original CRISPR CGGGGCCCTGCTCTCCTTTG GGG Exonic
900629399 1:3625522-3625544 CGGGGCTGCGCTCTCCTTGGTGG + Intronic
900999562 1:6142044-6142066 GGGTGCCGTGCACTCCTTTGGGG - Intronic
901206487 1:7500562-7500584 CGCGGCCCTGCTCCCCTGGGTGG + Intronic
901210277 1:7520612-7520634 GGGGCCCCTGCTCCCCTCTGGGG - Intronic
901871403 1:12140977-12140999 TGAGGCCCTGCTCTGTTTTGGGG + Intronic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
904614067 1:31740415-31740437 TGGGGACCTGCTCTTCTCTGTGG - Exonic
905732088 1:40304367-40304389 GGGGGCCCTGCTCCCCCTTAGGG + Exonic
906526896 1:46498861-46498883 AAGGCCCCTGCTCTCCTCTGAGG - Intergenic
912473493 1:109921825-109921847 GGGGGCCCTGATCTCCTTCCAGG + Exonic
915228508 1:154428873-154428895 CAGGGCCCTTCTGTCCTTGGAGG - Intronic
915946387 1:160155179-160155201 TGGGGCCATTCTCTGCTTTGTGG + Exonic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
920215680 1:204360157-204360179 GGTGGCCCTGCTCCCCTTTGGGG - Intronic
921338008 1:214107652-214107674 CAGGGCTCAGCTCTCCTTTCAGG - Intergenic
922616135 1:226962214-226962236 GGGGGCCCTCCTTTCCTTGGTGG + Intronic
923925908 1:238627014-238627036 CTGGGCCCTGCAATCCATTGAGG - Intergenic
1062798110 10:359245-359267 GGTGGCCCTGCTCTCCCTGGGGG - Intronic
1063092392 10:2878877-2878899 GGGGTCCCTGCTGTCCTCTGTGG + Intergenic
1064247345 10:13679632-13679654 CGGGGAGCTGCTCTGTTTTGAGG - Intronic
1064596567 10:16951513-16951535 AGGAGCCCTGCCCTCCTTTGAGG - Intronic
1069817916 10:71210273-71210295 CCGGGCCCTGCTCTCCCTCCAGG - Intergenic
1070761975 10:79029635-79029657 CGGGGCCCTATTCCCCGTTGCGG + Intergenic
1072490590 10:95902210-95902232 CTGGGCCTTGTTCTCTTTTGGGG + Intronic
1074902546 10:117831438-117831460 CGGAGCAGTGGTCTCCTTTGAGG - Intergenic
1075681003 10:124331167-124331189 CAGGGCCCTGCTCTCTTTGAAGG - Intergenic
1076139789 10:128069887-128069909 CAGGGCCCTGCACACCTGTGTGG - Intronic
1076572338 10:131440959-131440981 CGGGGCCCTGCCCCACTGTGAGG - Intergenic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1076754748 10:132563314-132563336 CGGGGCCGAGCTCTGCTCTGGGG + Intronic
1076804247 10:132847241-132847263 CGGGTCCCTGCTGGACTTTGTGG + Exonic
1077318700 11:1930437-1930459 GGGGCCCCTGCTCCCCTTTGGGG + Intronic
1077398141 11:2336721-2336743 AGGGGCCTAGCTCTCCCTTGGGG + Intergenic
1083987036 11:66222296-66222318 CGGGGCACTGCTCCCCTCTATGG - Intronic
1084303803 11:68268183-68268205 CCGGGCCATGCCATCCTTTGTGG + Exonic
1084676870 11:70640430-70640452 CAGGGCCCTGCTCCCCATGGTGG - Intronic
1085532389 11:77199618-77199640 CGGGGCCCTGTTCTCCGTGTTGG + Exonic
1086011524 11:82109576-82109598 CTGGGCCCAGTTCTGCTTTGTGG + Intergenic
1091239571 11:134043503-134043525 GGGGGCTCTGCTCTGCTGTGGGG - Intergenic
1092061115 12:5551319-5551341 CTAGTCCCTGCTCTCCATTGAGG - Intronic
1092541068 12:9420030-9420052 AGGGGCCCTGCTCCTCTCTGTGG - Intergenic
1094511976 12:31102456-31102478 AGGGGCCCTGCTCCTCTCTGTGG + Exonic
1095764781 12:45882232-45882254 CAAGGCCCAGGTCTCCTTTGTGG + Intronic
1096183831 12:49565734-49565756 TGGGCACCTGCTCTCTTTTGGGG - Intronic
1101399152 12:104373144-104373166 CGGGATGCTGCTCTCCTCTGGGG - Intergenic
1103560294 12:121790003-121790025 CGGGGCCCTGACATCCTCTGAGG - Intronic
1105024401 12:132838696-132838718 TGGAGCCCTGCTCTCCTTGTGGG - Intronic
1111931543 13:94517907-94517929 GGGGACCATGCTTTCCTTTGAGG - Intergenic
1113318470 13:109208620-109208642 TGGGGCCCTGCTGACCTTGGAGG - Intergenic
1113618202 13:111695777-111695799 GGAGGCCCTCTTCTCCTTTGGGG - Intergenic
1113623733 13:111781038-111781060 GGAGGCCCTCTTCTCCTTTGGGG - Intergenic
1113717476 13:112522659-112522681 TAGGGCTCTGGTCTCCTTTGTGG - Intronic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1117815456 14:59593141-59593163 CAGGGCCCTGCTCTCTTTTTCGG - Intergenic
1118880044 14:69818061-69818083 GGGGGCCCACCTCTCCTTGGAGG + Intergenic
1119205603 14:72791447-72791469 CAGGGCACTGCTCTCCCTGGTGG - Intronic
1119830408 14:77697106-77697128 CAGGTCACTGCTCTTCTTTGGGG - Intronic
1121282898 14:92712069-92712091 CGTGTCCCTGCCCTCCTGTGTGG - Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1122130118 14:99600061-99600083 AGTGGCCCTGCTGTCCTTTCTGG - Intronic
1122154578 14:99742502-99742524 CGGGTCCCTCCTCTTCTGTGTGG - Intronic
1122228891 14:100295319-100295341 GGGTGCCAGGCTCTCCTTTGAGG + Intronic
1122810292 14:104284370-104284392 CGGGGCCCTGCTGGCCTCTGCGG + Intergenic
1122983401 14:105201584-105201606 GGGGACCCTCCTTTCCTTTGCGG - Intergenic
1123663409 15:22586407-22586429 CGGGGCCCTGCACTGCCTGGCGG - Intergenic
1123782981 15:23645508-23645530 AGGGGCCCTGCGCTCCTTCGAGG + Exonic
1124259457 15:28175529-28175551 CGGGGCCCTGCACTGCCTGGCGG - Exonic
1124317239 15:28680839-28680861 CGGGGCCCTGCACTGCCTGGCGG - Intergenic
1125507261 15:40274029-40274051 CTGGCCCCAGCTCTCCTTGGTGG - Intronic
1130064352 15:80592143-80592165 CCTGGCTCTGCTCTCCTCTGTGG + Intronic
1131146713 15:90018697-90018719 CAGGGCCCAGCTTTCCTGTGTGG - Intronic
1132617468 16:848878-848900 CGGGGCCTCGCTCCTCTTTGCGG + Intergenic
1133034269 16:3026281-3026303 CGTGGCCCTGCTCACCTGTATGG - Exonic
1134627216 16:15730813-15730835 GGGTGCTCTTCTCTCCTTTGGGG - Intronic
1138349911 16:56340997-56341019 CGGGGGCCTGCTGTCCCTGGAGG - Intronic
1139350555 16:66332455-66332477 GGGGACCCTGCTTTCCTTTCTGG - Intergenic
1139967835 16:70755429-70755451 CGGGTCCCTGCTCTGCAGTGAGG + Intronic
1140224530 16:73067047-73067069 CGGGGCCCTGCTCGCCTCCAAGG + Intergenic
1141702907 16:85650598-85650620 CGCGCCCCTGCTCTGCTCTGGGG - Intronic
1142204500 16:88776493-88776515 CGGGGCCCAGCTTCCCTTGGAGG + Intronic
1142669594 17:1481895-1481917 CGGGCCCCTGCTCTCTTCTCTGG + Intronic
1142766261 17:2065894-2065916 CTGGGCCCTGCCCTCCTCTTGGG + Intronic
1143082120 17:4389376-4389398 CGGGGCCCTGCTAGCTTCTGTGG - Intergenic
1143110799 17:4551798-4551820 AGGTGCCCTGCTCCCCTTTTTGG + Intronic
1145251187 17:21297857-21297879 CTGGGCCCTGCTCACCCTGGAGG - Intronic
1146835409 17:36106764-36106786 TGGGGCCCTGCACTTCTCTGGGG + Intergenic
1148717948 17:49729205-49729227 CAGGGCCCTGGTCTCCTCTCAGG + Intronic
1149594426 17:57855822-57855844 CCAGGCCCAGCTTTCCTTTGAGG + Intergenic
1152068732 17:78124967-78124989 CGGGGTCCTGCTCTTCTCTCTGG + Exonic
1152242027 17:79165828-79165850 TGCTGCCCTGCCCTCCTTTGGGG - Intronic
1152554258 17:81045282-81045304 TGGGGCCCTGCTTCCCTTTCAGG - Intronic
1152644018 17:81460636-81460658 CGGGGCCGTCCTGTGCTTTGGGG - Exonic
1154100840 18:11472082-11472104 GGCTGTCCTGCTCTCCTTTGCGG + Intergenic
1159439687 18:68461413-68461435 CAGGGCCATGTTATCCTTTGGGG + Intergenic
1160017196 18:75154042-75154064 GGTGTCCCTGCTCTCCTCTGGGG + Intergenic
1160796735 19:949174-949196 TGGGGCCCTGCTCTGCATTTGGG - Intronic
1161058930 19:2204771-2204793 CGTGGCCCTGCTCATGTTTGAGG + Intronic
1161404476 19:4083983-4084005 GGAGGCCCTGCTCTCCTGAGGGG + Intergenic
1161611252 19:5244192-5244214 CCGGGGCCTGCTCGCCTGTGCGG + Exonic
1162756718 19:12865251-12865273 GGGGGCACAGCTCTCCCTTGAGG + Intronic
1162932123 19:13962541-13962563 CGGGGCCCTCCTCCCTTATGGGG - Exonic
1164444145 19:28302797-28302819 TGTGGCCTTGCTCTCCTTTATGG - Intergenic
1165351803 19:35279692-35279714 TGGGTCCCTGCTCCCCTTTGGGG + Exonic
1165891614 19:39115927-39115949 CGTGGCCCTGCTTCCCTTTCTGG - Intergenic
1166021769 19:40037720-40037742 CAGGGCACTGTCCTCCTTTGTGG + Intronic
925990363 2:9249769-9249791 CACGGCCCTGCCCTCCTCTGGGG - Intronic
926302917 2:11617269-11617291 AGGGGCTCTGCCCTCCTCTGCGG - Intronic
926303154 2:11618372-11618394 AGGGGCTCTGCCCTCCTCTGCGG - Exonic
926954634 2:18281031-18281053 TGGGCCCCTTCTCTCCTTTCAGG + Intronic
927102293 2:19797333-19797355 CTGGGCCCTGCACTTCTCTGTGG - Intergenic
929662465 2:43801512-43801534 CGGGGCAATGCTCTCATTAGTGG + Intronic
929906615 2:46051522-46051544 GGTGGCTCTGCTCTCCTTTGGGG + Intronic
929960163 2:46490423-46490445 CAGGGCCCTGCTCTCAGTGGGGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935157412 2:100495735-100495757 CAGGGCCCTGCTCTCCTGAACGG - Intergenic
935748633 2:106211314-106211336 CGGAGCACTTCTCTCATTTGGGG - Intergenic
935945219 2:108280029-108280051 CTGGGCCATGCTTCCCTTTGTGG - Intergenic
940654028 2:156466910-156466932 CAGGCTCCTGCCCTCCTTTGAGG + Intronic
942228295 2:173835957-173835979 CTGGGGCCTGCTCTCCTGGGAGG - Intergenic
943670960 2:190659724-190659746 CGCCTCACTGCTCTCCTTTGGGG - Exonic
944471993 2:200063561-200063583 TGGGGTCTTGCTCTCCTTGGAGG + Intergenic
946172500 2:217903925-217903947 AAGAGCCCTGCTTTCCTTTGAGG + Intronic
1168924389 20:1567215-1567237 CTGGGGCTTTCTCTCCTTTGAGG + Intronic
1169263862 20:4155946-4155968 CTTGGCCTTGCCCTCCTTTGAGG - Intronic
1170556604 20:17519810-17519832 GTGGGCCCTACTCACCTTTGGGG - Intronic
1172293291 20:33791191-33791213 CGGGGGGCTGCCCTCCTCTGGGG - Exonic
1173117936 20:40263645-40263667 CTGGCCCCTGCTCTTCTCTGAGG - Intergenic
1175493724 20:59397532-59397554 CTGAGCCGTGCTCTCCTGTGTGG + Intergenic
1179175082 21:39002328-39002350 GGCGGCGCTGCTCTCCTTTCTGG - Intergenic
1181116383 22:20634729-20634751 CCTGCCCCTGCTCTGCTTTGTGG - Intergenic
1181391736 22:22588116-22588138 GGAGGCCCTGCCCTCCTCTGAGG + Intergenic
1181462672 22:23094716-23094738 CTGGCCCCTGCTTTCCCTTGAGG - Intronic
1184200704 22:42967279-42967301 CTGGTCCCTGCTCTCCTTTGAGG - Intronic
1185116590 22:48941526-48941548 GGGGGACTTGCTGTCCTTTGGGG + Intergenic
1185163626 22:49244369-49244391 CTGGGCTCTGCTCTCCCTCGAGG - Intergenic
952968938 3:38638466-38638488 AGGGGCCCTGTGCTCATTTGTGG - Intronic
953752335 3:45618358-45618380 AAGGGCCCTGCTGTCCTATGGGG + Intronic
958892361 3:99795449-99795471 GGAGGCCCGGCTCCCCTTTGGGG - Exonic
960677551 3:120211203-120211225 GGGCTCCCTGCTCTCCCTTGGGG + Intronic
961002385 3:123382986-123383008 CTGGGCCCTGCACTCCTTCCAGG + Intronic
961010591 3:123433195-123433217 TGGGGCCCTGCCTGCCTTTGTGG - Intronic
961522157 3:127473140-127473162 CAGGGCCCAGGGCTCCTTTGAGG + Intergenic
967473668 3:189891235-189891257 CGGTGCCCTGCTATCCTTTCTGG - Intronic
967805211 3:193709713-193709735 CAGGGCCCAGCTCTGCTCTGTGG + Intergenic
967969379 3:194987880-194987902 CAGGGCCGTCCTCTCCTCTGAGG + Intergenic
969892942 4:10276558-10276580 CTGGCCCCCGCTTTCCTTTGTGG + Intergenic
980428551 4:132658822-132658844 CGGGGTCCTGCCCTTCTTGGAGG - Intergenic
981883026 4:149638806-149638828 CAGGGCCCTGCTCTCCTTCTTGG - Intergenic
982094774 4:151911918-151911940 CTGAGCACTGCTCTCCTTTGGGG - Intergenic
985468456 5:20611-20633 CGAGGTGCTGCTGTCCTTTGTGG - Intergenic
986349998 5:6868378-6868400 TGGGGGCCTGCTCCACTTTGAGG + Intergenic
988737080 5:34033327-34033349 GGTAGCCCTTCTCTCCTTTGGGG + Exonic
992614185 5:78534001-78534023 TGGAGCCCTGCTCTCCTGAGTGG - Intronic
995544809 5:113219341-113219363 GGGGGCCCTGAACTCCTGTGAGG + Intronic
1001124955 5:169011033-169011055 CTGAGCCCTGCTCTTCTTTCTGG - Intronic
1001857511 5:175025651-175025673 TGGGGCCCTACTGGCCTTTGGGG + Intergenic
1002038496 5:176492381-176492403 CTGGGCTGTGCTCTCCTTTGAGG - Intronic
1002175265 5:177398010-177398032 CGGGGCCCTGCTGGCCTTCGTGG + Exonic
1006801942 6:36765259-36765281 CTGGGCCCTGCCCTCCCATGCGG - Intronic
1007663372 6:43500120-43500142 CAGGGGCCTACTCTGCTTTGTGG + Intronic
1013111847 6:107070521-107070543 GGTGGACCTGCTCTCCCTTGAGG - Exonic
1016997655 6:149971406-149971428 CTGGGTCCTGCTCTCCCTTCAGG + Exonic
1017001153 6:149998825-149998847 CTGGGTCCTGCTCTCCCTTCAGG - Intergenic
1017842558 6:158232998-158233020 CGGCGTCCTGCTCTGCGTTGTGG - Intronic
1019077891 6:169405100-169405122 AAGGGCCCTGTTCTCTTTTGAGG + Intergenic
1019270614 7:145279-145301 CAGGGCCATTCTCACCTTTGGGG + Intergenic
1019295011 7:269420-269442 CGGGACCCTCCTCTCATCTGGGG + Intergenic
1019295045 7:269534-269556 CGGGACCCTCCTCTCATCTGGGG + Intergenic
1019303716 7:322442-322464 CAGGGCGCTGCTCTCTTTCGGGG - Intergenic
1019452845 7:1108411-1108433 AGGGGGGCTGCTCTCCTTGGCGG + Intronic
1020138150 7:5598034-5598056 AGGGGCCCTGCTCTACTGGGGGG + Intronic
1021939685 7:25667457-25667479 CGGTGCCCTGCTCTCTACTGTGG + Intergenic
1023541950 7:41275258-41275280 TGAGTCCCTGCTCTTCTTTGTGG + Intergenic
1023826619 7:44014328-44014350 CGGGGACCTACTGTCCTTTGGGG - Intergenic
1024573738 7:50747305-50747327 TGGGGACCTGCTCTGCTTCGCGG - Intronic
1025004842 7:55345401-55345423 CGGGCCCCTGCTCTTCTCAGTGG - Intergenic
1029737778 7:102474083-102474105 CGGGGACCTACTGTCCTTTGGGG - Intronic
1029754909 7:102567732-102567754 CGGGGACCTACTGTCCTTTGGGG - Intronic
1029772859 7:102666812-102666834 CGGGGACCTACTGTCCTTTGGGG - Intronic
1033763871 7:144466068-144466090 CGGTGCCCTGCTTTCCTCTTTGG + Intronic
1034274236 7:149817052-149817074 CGGGGCCCAGCTCTGCTCTGGGG + Intergenic
1034939560 7:155221448-155221470 CAGGGACCTGCTCACCTTGGGGG - Intergenic
1035040591 7:155924023-155924045 CAGGGCCCTTCTCTTCTTAGAGG - Intergenic
1039890286 8:41681387-41681409 CTGGGCCGTCCTCTCCTATGTGG + Intronic
1041439208 8:57875598-57875620 AGGGGTCCTGCTCTCCGTGGTGG - Intergenic
1044693483 8:94900659-94900681 CGGGGCCCTGCTCTCCACTGAGG + Intronic
1045474749 8:102543297-102543319 CTGGGACCTGCTCTCCAATGAGG - Intergenic
1047822024 8:128531371-128531393 CAGGGCCTTCCTCTGCTTTGGGG - Intergenic
1049631354 8:143659907-143659929 CAGGGCTCTGCTCTCATTTGTGG - Intergenic
1049850368 8:144827293-144827315 CTGGGCCCTCCTCTCCCTCGCGG + Intergenic
1050027378 9:1349889-1349911 CAGGGCCATGCTCTCTTTGGAGG - Intergenic
1056214916 9:84397792-84397814 CTGGGCCACGTTCTCCTTTGTGG + Intergenic
1056659112 9:88531969-88531991 CAGGGCCCTGCACTCACTTGGGG - Intergenic
1056873456 9:90305926-90305948 CGGGTCCCAACTCTCCTCTGAGG + Intergenic
1059388734 9:113985504-113985526 CGGGCCCGTGCTCCCCTCTGGGG + Intronic
1060891673 9:127193167-127193189 CGGGGCCCTTCTCTTCTCTCAGG - Intronic
1061084810 9:128392716-128392738 CAGGGCCCTGGTCTCCTGCGGGG + Intergenic
1061145266 9:128794048-128794070 GGAGGCCCTGTTTTCCTTTGGGG + Intronic
1061360698 9:130140439-130140461 CGGGGCACTGCTGCCATTTGAGG + Intergenic
1061569763 9:131469981-131470003 CGGGGACCTGGTCTCGTCTGGGG + Intronic
1061621622 9:131814487-131814509 CGGAGCCCTGCTCCCCTTATTGG - Intergenic
1061836446 9:133332931-133332953 GGGGTCCCTTCTCTCTTTTGGGG - Intronic
1062067851 9:134538381-134538403 AGGGGCCTGGCTGTCCTTTGTGG + Intergenic
1187560653 X:20399801-20399823 AGGGCCCCTGCTCCCCTTTCTGG + Intergenic
1189376856 X:40473398-40473420 CGGGGCCTTGCTGACCTTGGAGG + Intergenic
1200163403 X:154020203-154020225 CGGAACCCTGCTCTCCACTGCGG + Intergenic