ID: 904603104

View in Genome Browser
Species Human (GRCh38)
Location 1:31684294-31684316
Sequence CAGAGTGTTCAGAGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904603104_904603111 5 Left 904603104 1:31684294-31684316 CCTGCACCCCTCTGAACACTCTG 0: 1
1: 0
2: 2
3: 17
4: 212
Right 904603111 1:31684322-31684344 TGAATGCTCCCACGTCAGCCTGG 0: 1
1: 0
2: 2
3: 9
4: 134
904603104_904603112 6 Left 904603104 1:31684294-31684316 CCTGCACCCCTCTGAACACTCTG 0: 1
1: 0
2: 2
3: 17
4: 212
Right 904603112 1:31684323-31684345 GAATGCTCCCACGTCAGCCTGGG 0: 1
1: 0
2: 3
3: 37
4: 162
904603104_904603115 19 Left 904603104 1:31684294-31684316 CCTGCACCCCTCTGAACACTCTG 0: 1
1: 0
2: 2
3: 17
4: 212
Right 904603115 1:31684336-31684358 TCAGCCTGGGAAATCAAAACAGG 0: 1
1: 0
2: 2
3: 22
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904603104 Original CRISPR CAGAGTGTTCAGAGGGGTGC AGG (reversed) Intronic
901037279 1:6343900-6343922 CTGGGTGTACAGAGGGGTGTGGG + Intronic
902275299 1:15335173-15335195 CAGTGTGTTCGGAAGGGTGGAGG + Intronic
902786239 1:18734408-18734430 CAGTGAGTTCAGAGGAGGGCAGG - Intronic
904052064 1:27645746-27645768 CAGAGTATTCGAATGGGTGCTGG + Intergenic
904213119 1:28898684-28898706 CCAAGTCTTCAGAGGGGTGCTGG + Intronic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
909177612 1:72380571-72380593 CATAGTCTTCAGTGGGGTACTGG - Intergenic
910465441 1:87494171-87494193 CAGTGTCTGCAGAGAGGTGCAGG + Intergenic
910601298 1:89035170-89035192 CACAGTGATCAGAGTGGTGAAGG + Intergenic
910759438 1:90719754-90719776 GACAGTGGCCAGAGGGGTGCGGG + Intergenic
913139734 1:115928796-115928818 TAAAGTGTTCAGCGGGGGGCCGG - Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915294309 1:154909389-154909411 CAGAGAGCTCAGAGGGTTGCAGG + Intergenic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
917161802 1:172065543-172065565 CAGAGAGTCAAGAGGGGTTCTGG + Intronic
918037993 1:180894203-180894225 CAGAATGTTCTGAGGGGTTCAGG - Intergenic
918243124 1:182637421-182637443 CAGGGTGTTGTCAGGGGTGCTGG - Intergenic
920616309 1:207496142-207496164 CAGAGTGTGGGGAGGGCTGCGGG - Intronic
921276548 1:213526254-213526276 CAGAGAGTCCAGAGGGTTGTTGG + Intergenic
923866684 1:237947199-237947221 CAGAGGATTCAGAGGGGACCAGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
1063804676 10:9624828-9624850 CAGAGTTTACTGAGGGGTCCAGG - Intergenic
1070395217 10:76006271-76006293 GAGGGTGTTCAGAGGAGTGAGGG + Intronic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1074051824 10:109887419-109887441 CAGATTGCCCAGAGGGGTCCTGG - Intronic
1074721608 10:116270566-116270588 CAGAGAGGTCAGCGGGGTCCCGG + Intronic
1074892095 10:117744208-117744230 CAGAGTGGTCAGAGAGGGCCAGG + Intergenic
1075182136 10:120220835-120220857 CAGAGAGACCAGAGGTGTGCTGG - Intergenic
1075201877 10:120411291-120411313 AAGAGTGTCAAGGGGGGTGCTGG + Intergenic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1076585883 10:131547413-131547435 CAGGGTGTTCAAAGGTGGGCAGG + Intergenic
1076858837 10:133130130-133130152 CTGAGTGGGCAGAGGTGTGCAGG - Exonic
1077824367 11:5788565-5788587 GAGAGTGTTGGGAAGGGTGCTGG + Exonic
1080587251 11:33693262-33693284 CAGAGTGTTTACAAAGGTGCAGG - Intergenic
1083235684 11:61349386-61349408 CAGAGTGGTCAGAGGGGCTGGGG + Exonic
1083891623 11:65598427-65598449 CAGGGTGCTCGGCGGGGTGCAGG + Exonic
1087830103 11:102810336-102810358 TAGAGTTTTCTGAGGGGTTCTGG - Intergenic
1087890910 11:103537093-103537115 CAGAGTCTTGTGAGGGGCGCAGG - Intergenic
1089396310 11:118138143-118138165 CAGAAAGCTCAGAGGGATGCAGG - Intronic
1089967319 11:122664168-122664190 TAGAGTGCCCAGAGGGGTGCGGG + Intronic
1090493074 11:127182940-127182962 CAGAGTGATCACAGGAGTGGAGG + Intergenic
1090820294 11:130336217-130336239 CAGAGTGGGCTGATGGGTGCTGG - Intergenic
1091815970 12:3438189-3438211 CATTGTGTTCAGAGAGGTGGAGG + Intronic
1091825651 12:3510771-3510793 CAGAGTTTTCAGAGGTCTTCAGG + Intronic
1095315260 12:40753112-40753134 CAGAGTATTCACATGGTTGCAGG - Intronic
1096567288 12:52492511-52492533 CAGAGAGTGCAGATGGCTGCTGG - Intronic
1098790679 12:74817686-74817708 CAGAGTGATGAGAGGTGTGTGGG - Intergenic
1102162706 12:110782431-110782453 CAGGGAGTGCAGAGAGGTGCAGG + Intergenic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1108942666 13:55977249-55977271 CAGGCTGTTCAGAGGGTTCCAGG - Intergenic
1109969006 13:69739928-69739950 CAGAGTGTTTAGAAGTGTCCTGG - Intronic
1112323685 13:98429362-98429384 CAGAGAGGTCAGAGGGATCCCGG + Intronic
1113120953 13:106923519-106923541 CTGAGTGATGAGAGGGGTCCAGG + Intergenic
1113641553 13:111961249-111961271 CAGAGAGACCAGTGGGGTGCAGG - Intergenic
1115802713 14:37013665-37013687 CAGAGTGGTGAGGGGGGTGAGGG - Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1128075176 15:64821342-64821364 CAGTATGTTCAGAGGGCAGCAGG - Intronic
1128810578 15:70569009-70569031 CAGAGGGTTCAGAGGAGGGTTGG + Intergenic
1129295814 15:74599487-74599509 AACAGAGTTCAGAGGGGTTCCGG + Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131021559 15:89103616-89103638 CAGAATGTTCAGGGGGGTAAGGG + Intronic
1131422670 15:92320295-92320317 GAGAGTTGTCAGAGGGGTGTGGG - Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1134511703 16:14853700-14853722 CAGCGTGTTCAGAGAACTGCAGG - Intronic
1134972483 16:18542476-18542498 CAGCGTGTTCAGAGAACTGCAGG + Intronic
1136606274 16:31336212-31336234 CTCAGTGTTCCGAGGGGTGCAGG - Intergenic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1139318288 16:66092104-66092126 CAGAGTGGGCTGAGGGGTTCTGG - Intergenic
1139397342 16:66650702-66650724 CAAAGTGTTAAGAGGTGTGCGGG - Intronic
1139467904 16:67164063-67164085 CAGAGTCCGCAGAGGGGTGGAGG - Exonic
1139833728 16:69821518-69821540 CAGAGTGTTCTGTGAGGTGTCGG + Intronic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1142279611 16:89141081-89141103 CAGAAGGTTCAGAGGGCTCCAGG - Intronic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1143914956 17:10284057-10284079 AAGAGTGTTCTGAGGTGAGCAGG - Intergenic
1147317138 17:39626477-39626499 GAGAGTGTGCAGGGGTGTGCCGG - Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151696307 17:75719823-75719845 CAGAGTGATTGCAGGGGTGCTGG - Intergenic
1152277014 17:79363812-79363834 CAGAGAGTTCTGAGTGGGGCAGG - Intronic
1152451192 17:80381507-80381529 CAGAGTGTTCAGCGGGGATCTGG - Intronic
1152941543 17:83175382-83175404 CAGATTTTTCAGAGGGGTAGTGG + Intergenic
1160513077 18:79463358-79463380 CAGGGTGCTCAGAAGGGTCCTGG + Intronic
1161777687 19:6272611-6272633 CAGAGAGTTCACAGGGGCCCTGG - Intronic
1161798746 19:6403442-6403464 CAGAGTGTTGAGAACAGTGCTGG - Intergenic
1161902352 19:7128822-7128844 CAGTGAGTTCAGTGGTGTGCTGG - Intronic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162797735 19:13095400-13095422 CGGACTGTACAGAGGGGTCCAGG - Exonic
1163290552 19:16376737-16376759 CAGAGTGGCCACAGGGCTGCCGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164616193 19:29668145-29668167 TTGAGGGTTCAGAGGGGTGGGGG - Intronic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1166571958 19:43802653-43802675 CAGAGTGCTGGGAGGGGTGAAGG - Intronic
1168579528 19:57543071-57543093 CAGAGTGATCAGAAGAGTGTAGG - Exonic
925206417 2:2010879-2010901 CAGACTCTTCACAGGGGTGCCGG + Intronic
925435411 2:3833113-3833135 AAGAATGCTCAGAGGGATGCAGG - Intronic
926075675 2:9941028-9941050 CAGAATGATCTGAGGGGTGCAGG - Intergenic
927214259 2:20657897-20657919 CAGAATGTTCACAGTTGTGCAGG - Intergenic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
934146166 2:89096010-89096032 CAGGGCGTTCAGATGTGTGCTGG - Intergenic
934221393 2:90087231-90087253 CAGGGCGTTCAGATGTGTGCTGG + Intergenic
934223099 2:90104565-90104587 CAGGGCGTTCAGATGTGTGCTGG + Intergenic
935554936 2:104499166-104499188 CTGGGTGGTCAGAGGAGTGCAGG + Intergenic
937235984 2:120432279-120432301 AAGGGAGCTCAGAGGGGTGCAGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
938996051 2:136679319-136679341 TGGAGTGTTTAGAGGTGTGCTGG + Intergenic
940750818 2:157625596-157625618 GAGGGGGTGCAGAGGGGTGCAGG + Intronic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
945654368 2:212605343-212605365 CAGAATGCTCAGATGGCTGCAGG - Intergenic
946480079 2:220046829-220046851 CAGAGTGTTGAGAGGGCAGGGGG - Intergenic
947391144 2:229640901-229640923 CAGAATGTCCAAAGGGGTGAGGG + Intronic
947930933 2:233964659-233964681 CAGAGTCTTCAGAAGCTTGCTGG - Exonic
948027213 2:234787620-234787642 CAGAGCTTACAGAGGGTTGCAGG - Intergenic
948999218 2:241602818-241602840 CTGAGTGTTGAGAGTGGTCCTGG - Intronic
949048809 2:241886013-241886035 CAGAGTATTTAGGGGGGTGGTGG - Intergenic
1169968904 20:11247635-11247657 CTGATTGTTGAGAAGGGTGCTGG - Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1173419956 20:42892385-42892407 CAGAGTGTTCAAAAGAATGCTGG - Intronic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174421255 20:50400481-50400503 AAGTGAGTTCAGAGGGGTGAAGG + Intergenic
1175207289 20:57321033-57321055 CAGAGTGTTCAGGGAGTTGGTGG + Intergenic
1175232135 20:57480719-57480741 CAGAGTGTACAGGGCCGTGCAGG - Intergenic
1175581632 20:60104347-60104369 CAGAGAATTCAGTGGAGTGCAGG - Intergenic
1177089261 21:16746072-16746094 CACAATGTCCAGAGAGGTGCGGG + Intergenic
1177612165 21:23465926-23465948 CATAATGTCCAGAGGGATGCTGG + Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178348169 21:31849957-31849979 CAGAGTGCTCAACGGAGTGCAGG + Intergenic
1180199637 21:46216483-46216505 CAGAGTGTGGAGGGGTGTGCCGG + Exonic
1180642856 22:17313333-17313355 CGAGGTGTGCAGAGGGGTGCAGG + Intergenic
1181872084 22:25907736-25907758 AAGAGTGTTGAGAAGGGGGCCGG + Intronic
1182256775 22:29044776-29044798 CAAAGTATTCAGTGGGTTGCTGG - Exonic
1182357583 22:29729277-29729299 GAGAGTCTGCAGAGGGGGGCTGG + Intronic
1182977705 22:34638979-34639001 CAGAGTGGTCAATTGGGTGCTGG - Intergenic
1183482144 22:38070950-38070972 CAGAGTGGCAACAGGGGTGCTGG + Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184400062 22:44268580-44268602 CTGAGTCTTCTGGGGGGTGCTGG - Intronic
1185181557 22:49366375-49366397 GAGAGTGTGCAGAGCGGTGCCGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951105457 3:18736854-18736876 CAGAGAATTCAGAGGGTTTCTGG + Intergenic
953196823 3:40742210-40742232 CAGAGTGTCCTGAGAGGGGCTGG - Intergenic
953655109 3:44845221-44845243 CAGAGAGGTCAGAGTGGTTCTGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
957521065 3:81319196-81319218 CATTGTGTTGAGAGGGATGCAGG - Intergenic
960668382 3:120132828-120132850 CAGTGTGATCAGTGGAGTGCAGG + Intergenic
961457810 3:127032953-127032975 CAGAGGGTGCAGAGGAGTGAAGG - Intronic
961509800 3:127393861-127393883 CAGAGTCTTCAGGGAGCTGCAGG + Intergenic
962814845 3:138988490-138988512 AAGAGTGGTCAGGAGGGTGCCGG - Intergenic
968768313 4:2486651-2486673 CAGAGTGGTGAGGGGTGTGCAGG + Intronic
968976545 4:3825043-3825065 CAGAGCCTCCAGAGGGGTCCTGG + Intergenic
969179093 4:5423774-5423796 CAGTGAGTCCAGAGGGGTGGTGG + Intronic
969829067 4:9781065-9781087 CAGGGTGTTGAGAGAGGGGCTGG + Intronic
972262264 4:37421147-37421169 CCGAGTTTTCAGAGGGGTAGTGG - Intronic
975315803 4:72952045-72952067 CAAAGTATTCACAGGGGTCCAGG - Intergenic
976116466 4:81733427-81733449 TGGAGTGTTGAGAGGGTTGCTGG + Intronic
976205476 4:82619602-82619624 CAGGGTGTTCAGCAGGGTGGAGG + Intergenic
981010812 4:139922942-139922964 CAGAGTGCTTGCAGGGGTGCCGG + Intronic
985701778 5:1377956-1377978 CAGAGCGCTCAGAGGGCAGCGGG - Intergenic
987037311 5:14031492-14031514 CAGAGTTATGAGAGTGGTGCTGG - Intergenic
987749139 5:22017250-22017272 AAGACTGTTCTGAGGGTTGCTGG + Intronic
991251127 5:64562649-64562671 CAGAGTGTTCACACTGGTGAAGG - Intronic
992163869 5:74029222-74029244 CAGATTGTTCAGGGGGCTGAAGG + Intergenic
995474776 5:112536838-112536860 CAGAGTCTACAAAGGGCTGCAGG + Intergenic
997509456 5:134443646-134443668 CAGATGGTTCAGAGGGGTCTGGG + Intergenic
998531245 5:142887029-142887051 CAGAGTATTCAGAGTTGAGCAGG + Intronic
999482052 5:151957715-151957737 CTGAGGTTTCAGAGAGGTGCTGG + Intergenic
1000443047 5:161285679-161285701 CAGAATGGTCAGAGAGATGCTGG - Intergenic
1001569466 5:172720752-172720774 CTGAATCTTCAGAGTGGTGCAGG + Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1003778170 6:9392616-9392638 CAGAGAGTTCAGAGGAGTGTGGG - Intergenic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006838896 6:37015643-37015665 GAGTGTGTTCAAAGGGGAGCGGG + Intronic
1007160971 6:39791908-39791930 CAGTGTGTCCCAAGGGGTGCTGG - Intergenic
1009448408 6:63771438-63771460 CAGATTGTTTAGATTGGTGCAGG - Intronic
1012635111 6:101528150-101528172 CAGAGTGCTTAGACTGGTGCTGG + Intronic
1014374597 6:120657465-120657487 CCCAGTGTTCAGATGGTTGCTGG + Intergenic
1018530041 6:164752668-164752690 CAGAGTATTCAGTGAGCTGCTGG + Intergenic
1018714901 6:166524699-166524721 TAGAGTGTGCAGAGTGCTGCCGG - Intronic
1021286562 7:18788043-18788065 CTGAGTGTTCAGAGGACAGCAGG - Intronic
1024088195 7:45914635-45914657 CAGAGCCCTCAGAAGGGTGCAGG - Intronic
1026759271 7:73114270-73114292 CACAATGTTCACAGTGGTGCTGG - Intergenic
1027088137 7:75279203-75279225 CACAATGTTCACAGTGGTGCTGG + Intergenic
1027584909 7:80045559-80045581 CAGAGGGTTCAGAAGGGGACAGG - Intergenic
1028153250 7:87400100-87400122 GAGAGTGTTCTGAGAGGTGAAGG + Intergenic
1029394245 7:100296361-100296383 CACAATGTTCACAGTGGTGCTGG + Intergenic
1031122825 7:117740825-117740847 CAGAGACTTCAGAGCAGTGCAGG - Intronic
1033311282 7:140263922-140263944 CAGTGTGTTCAGAGGGTCCCTGG - Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1046075432 8:109306643-109306665 TAGAGTGTCCAGTGGGGTCCGGG - Intronic
1046725643 8:117670718-117670740 CAGAGTATTGAGATGGTTGCAGG + Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049453470 8:142675224-142675246 CAGAGGGTGCAGAGTGGTGGGGG + Intronic
1049476300 8:142798425-142798447 CAGAATGTTCTGAGCAGTGCAGG - Intergenic
1049501693 8:142970852-142970874 CAGAGAGGGCAGAGGGGTGGAGG + Intergenic
1049501718 8:142970924-142970946 CAGAGAGGGCAGAGGGGTGGAGG + Intergenic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1052821247 9:33139361-33139383 CAGCGAGTTCAGAAGGGAGCAGG - Intronic
1055251144 9:74307208-74307230 CAGAGGGTTCATAAGGGAGCTGG - Intergenic
1056203844 9:84301404-84301426 AAGAGTGTTCAGAAGGGTCATGG + Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1058827491 9:108788003-108788025 CACAGTTTTAAGAGGGGTGGGGG + Intergenic
1059655411 9:116353325-116353347 CAGAGTGTTCTGATGTGTGTTGG - Intronic
1060013942 9:120070072-120070094 GAGAGTGTTCAGCAGGCTGCAGG + Intergenic
1060186089 9:121564989-121565011 CAGAGCGTTAAGAAGGCTGCGGG + Intergenic
1060500726 9:124152203-124152225 CAGAAAGTTCAGAGGAGTCCAGG - Intergenic
1060635215 9:125194749-125194771 CAGACTGGTCTGAAGGGTGCAGG - Intergenic
1060985612 9:127817469-127817491 CAAAGTGTTCACAAGGGTGAGGG - Intronic
1061113593 9:128593260-128593282 CTGTGTGTTCAGAGTGGTGTTGG + Intronic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1203759698 EBV:5757-5779 CAGAGTTTTCTGAGGAGGGCTGG - Intergenic
1185539357 X:889899-889921 CAGGGTCTTCAGATAGGTGCAGG + Intergenic
1186610304 X:11132234-11132256 CAGAGTATTCAAATAGGTGCTGG + Intergenic
1187181250 X:16946168-16946190 CAGAGTGTTCAGGGTGGTATTGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1188888890 X:35584937-35584959 AAGAGAGTACAGAGGGGTCCAGG - Intergenic
1189132843 X:38518132-38518154 AAGAGTGTTCTGTGGGGTCCTGG + Intronic
1190442165 X:50485611-50485633 CAGAGTGTTCAAAGGTCTGCAGG + Intergenic
1192327472 X:70145109-70145131 CAGAGAGTTCAGTGTGGTGGGGG - Intronic
1193569779 X:83128038-83128060 TAAAGTGTTCAGATGGGGGCAGG - Intergenic
1194984551 X:100476483-100476505 CACAGAGTTCAGATGGGTGCAGG - Intergenic
1197747287 X:129940153-129940175 GAGAGTGTTGAGAGAGCTGCTGG - Intergenic
1199810008 X:151339806-151339828 CAGAGTGTTCAGAAGCCTGATGG + Intergenic
1199995414 X:153021681-153021703 AAGAGTGGATAGAGGGGTGCAGG - Intergenic