ID: 904604457

View in Genome Browser
Species Human (GRCh38)
Location 1:31691211-31691233
Sequence GGCCACCTGGATCCCCCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904604444_904604457 11 Left 904604444 1:31691177-31691199 CCTATGCTCACCTTGTCTCCCTT 0: 1
1: 0
2: 2
3: 27
4: 311
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604449_904604457 1 Left 904604449 1:31691187-31691209 CCTTGTCTCCCTTGGGGCCTGGT 0: 1
1: 0
2: 3
3: 26
4: 254
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604440_904604457 30 Left 904604440 1:31691158-31691180 CCACGTGACCACACTCCCACCTA 0: 1
1: 0
2: 0
3: 9
4: 147
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604442_904604457 15 Left 904604442 1:31691173-31691195 CCCACCTATGCTCACCTTGTCTC 0: 1
1: 0
2: 0
3: 19
4: 340
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604453_904604457 -8 Left 904604453 1:31691196-31691218 CCTTGGGGCCTGGTGGGCCACCT 0: 1
1: 0
2: 5
3: 24
4: 258
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604443_904604457 14 Left 904604443 1:31691174-31691196 CCACCTATGCTCACCTTGTCTCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604441_904604457 22 Left 904604441 1:31691166-31691188 CCACACTCCCACCTATGCTCACC 0: 1
1: 0
2: 1
3: 37
4: 407
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188
904604452_904604457 -7 Left 904604452 1:31691195-31691217 CCCTTGGGGCCTGGTGGGCCACC 0: 1
1: 0
2: 1
3: 19
4: 170
Right 904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG 0: 1
1: 1
2: 0
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904604457 Original CRISPR GGCCACCTGGATCCCCCTGA GGG Exonic
900123335 1:1058864-1058886 GGCCCCCTGGACCCCACTCAGGG - Intergenic
900605792 1:3523030-3523052 GGCTGCCTGGATCCCCATGGTGG + Intronic
903300335 1:22374372-22374394 AGACACCTGGTTCCCCCTGCAGG - Intergenic
903651889 1:24927614-24927636 GGCCACCTGGTTCTTCATGACGG + Exonic
904130598 1:28272694-28272716 TGCCATCTGCATCCCCCTCAGGG - Exonic
904433059 1:30477650-30477672 GGCCGTCTGGATGCCCCTGCTGG - Intergenic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
906420271 1:45660226-45660248 GGCCAGCTGGATCTCCCACAAGG + Exonic
912715776 1:111982658-111982680 GGCCACCGGCATCCACCCGATGG + Exonic
913112235 1:115666823-115666845 GGGCATCTGGCTCTCCCTGAGGG - Intronic
919896583 1:202012997-202013019 GTGGACCTGGATCCCACTGATGG + Exonic
920031337 1:203039042-203039064 GACCGCCTGGGTCCCCCTCATGG + Intronic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
921719318 1:218452780-218452802 GGCCACATTTATCCCCCTGCAGG + Intergenic
923027771 1:230219599-230219621 GGACACCTGGATCCCCCTCCTGG + Intronic
1062862853 10:823648-823670 GGCCATGTGGCTCCCTCTGAGGG - Intronic
1065841235 10:29703270-29703292 GGTAACCTGGATCACCGTGAGGG + Intronic
1067728906 10:48794799-48794821 GGCCACCTGGAAGTCCCTGGTGG + Intronic
1069636146 10:69926065-69926087 GGCCACCTGGATGCCAGTAATGG - Intronic
1070151198 10:73806358-73806380 GGTCACCTGGATGCCCCACACGG + Exonic
1073026400 10:100490056-100490078 GGGCACCTGGGTCCCCTGGAAGG + Exonic
1073133428 10:101205551-101205573 CGCCACCTGGGACTCCCTGAGGG + Intergenic
1074419450 10:113295896-113295918 TGCCACCTGCATCCCCTTGCAGG - Intergenic
1076668813 10:132107957-132107979 AGCCAGCTGGATCTCCCTGAAGG - Intronic
1077497799 11:2894926-2894948 GCCCACCCGGAAGCCCCTGAAGG - Intronic
1079251296 11:18790139-18790161 GGACACCTGGCTGCCCTTGAGGG + Intronic
1081131108 11:39381417-39381439 TGCCACCTGGATGCCCCTCCAGG - Intergenic
1081993425 11:47349596-47349618 GGCCTCCGGGATCTCCCTGTGGG + Intronic
1085705162 11:78780530-78780552 GACCACTTGGATCCCAGTGATGG - Intronic
1088817043 11:113428499-113428521 TGCCACCCAGATCCCCCTGCAGG - Intronic
1091134920 11:133179988-133180010 GGCCACTAGGATCCCGCAGAAGG + Intronic
1101447940 12:104751196-104751218 GGCCACCTGAATCCCCAGGGAGG - Intronic
1101549307 12:105747315-105747337 GGCAACCTGGAGCCCCAGGATGG - Intergenic
1101882361 12:108634159-108634181 GGCCAGAGGGAGCCCCCTGAAGG + Intergenic
1102525644 12:113510603-113510625 GGCCACCAGAATCCCACTGGAGG - Intergenic
1104970897 12:132530262-132530284 GGCCACCTGGCTCCGGCTGCTGG + Intronic
1112621602 13:101058975-101058997 GGCCTCCTGGAGCACCCTGCTGG + Intronic
1113857978 13:113459360-113459382 GGACACCTGGAACCTCCTGCTGG - Exonic
1113967768 13:114164158-114164180 GGCCCCCTCGGTCCCCCTGCCGG - Intergenic
1114671631 14:24414876-24414898 AGCCTCCATGATCCCCCTGATGG + Exonic
1114672957 14:24422376-24422398 GCCCACCTGGAGCCCCCAGAGGG + Intergenic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG + Intergenic
1117914029 14:60658352-60658374 GGCCACCTGGATTCTACTGGAGG - Intergenic
1119853665 14:77883875-77883897 GGCCCCCTTGATTCCCCTGGTGG + Intronic
1122143312 14:99675048-99675070 GGGCGCCTGGGTCCCTCTGACGG + Intronic
1122439792 14:101722729-101722751 AGCCACCTAGATCCCCCTTCCGG - Intergenic
1122684684 14:103496136-103496158 GGCAACATGGATCAACCTGAGGG - Intronic
1202832164 14_GL000009v2_random:46843-46865 GGCCACGTGGATCAGTCTGACGG - Intergenic
1123701067 15:22915102-22915124 TTCCCCCTGGATCCCACTGAAGG - Intronic
1128319089 15:66680097-66680119 GGAAACCTGAATCCCCCTGGAGG - Intronic
1128338788 15:66805383-66805405 GGCCTTCTGGATCCCCCTCTAGG - Intergenic
1132591843 16:729507-729529 GGCCAGCTGGACCCACATGAGGG + Exonic
1135327555 16:21536724-21536746 GGTCACCTGGATCATCCAGAAGG - Intergenic
1136337905 16:29622744-29622766 GGTCACCTGGATCATCCAGAAGG - Intergenic
1138541207 16:57688882-57688904 GGCCTCCTGAATGCCCCTCAAGG - Exonic
1138658603 16:58504478-58504500 AGCCACCTGGCTCCAGCTGAGGG + Intronic
1141089041 16:81117435-81117457 GGCCAGCTGGAGCGCCCTGGCGG - Intergenic
1141641634 16:85344889-85344911 GGTCACCTGCATCTGCCTGAAGG - Intergenic
1141727411 16:85799200-85799222 GGCCACCAGGAGCCCGTTGACGG + Exonic
1142040668 16:87891825-87891847 GGTCACCTGGATCATCCAGAAGG - Exonic
1142253678 16:89003709-89003731 TGCCAGCTGGGTGCCCCTGATGG - Intergenic
1142274963 16:89113581-89113603 GGCCATCTGGATCTCCCAGCGGG + Intronic
1142429659 16:90019325-90019347 GGCCGCATGGAGCCCCCGGAGGG - Intronic
1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG + Intronic
1145755671 17:27388521-27388543 GGCCAACTGGGTCCCCCTGGTGG + Intergenic
1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG + Intronic
1148325976 17:46783741-46783763 TGCCACCTGGCTCCACCTGAGGG - Intronic
1148342384 17:46881079-46881101 GCCCACCAGGATCCTCCTGGGGG + Intronic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1149982369 17:61321557-61321579 GGCCATCTGGATGCCCCTGCAGG + Intronic
1150815024 17:68386080-68386102 GGCCTCCTGGATCTGCCTTAAGG - Intronic
1151698300 17:75729377-75729399 GGCAACCTGGATGCTCCTGAGGG + Exonic
1151767504 17:76139960-76139982 GGCCACCAAGATCACCCTGTCGG - Exonic
1152623169 17:81376015-81376037 GGCACCCTGGAGACCCCTGAGGG - Intergenic
1152743683 17:82029657-82029679 GGCAGCCTGGCTCCCCCGGAGGG - Intronic
1153143350 18:2000461-2000483 GGTCTCCTGGATCCTCCAGAAGG + Intergenic
1153541399 18:6159655-6159677 TGCCACATGGCTCTCCCTGAAGG + Intronic
1154290465 18:13102055-13102077 GGGCACCAGGAACCCCCAGAAGG - Intronic
1157571358 18:48714403-48714425 GGCCAGCTGTATCCCTCTGGTGG + Intronic
1160450811 18:78965111-78965133 GGCAGCCTGGATCCCACCGACGG - Intergenic
1160450829 18:78965172-78965194 GGCAGCCTGGATCCCACCGACGG - Intergenic
1160519506 18:79496401-79496423 GGCCACCTCTCTCCCTCTGACGG - Intronic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1161327490 19:3670730-3670752 GGCCACCTGGATGCCCTGCAGGG + Intronic
1161470416 19:4454243-4454265 GGCCACCTGCAGCCACCAGATGG + Intronic
1165313446 19:35041551-35041573 GCACACCTGGGTCCCCCTGGAGG + Intronic
1165903955 19:39182036-39182058 GGGCACCGGCATCCCCCGGAGGG - Intronic
1166941645 19:46370479-46370501 TGCCTTCTGGATACCCCTGAAGG + Intronic
1167653787 19:50749709-50749731 GGCCCCCCGTATCCCCCTTAAGG + Intergenic
1168328300 19:55550003-55550025 GGCCACCTGGGTCCCCCGGGAGG + Intergenic
925717958 2:6802208-6802230 GGCCGCCTGGATCCCTTTCATGG - Intergenic
927617410 2:24613419-24613441 GGCCACCTACAGTCCCCTGATGG + Intronic
931204902 2:60137558-60137580 GTCCACATGGAACCCCCTGCAGG + Intergenic
935203702 2:100880060-100880082 GGCCAACTGCATCCCTCGGATGG + Intronic
937236047 2:120432482-120432504 TGCCTCCTGGCTCTCCCTGAGGG + Intergenic
937261799 2:120591361-120591383 GCCCACCTGGGTCCCCCAGCAGG - Intergenic
938422454 2:131155628-131155650 GTCCACGTGGAGCCTCCTGAGGG - Intronic
944217476 2:197270532-197270554 TTCCACCTGGATGTCCCTGAAGG - Intronic
945417104 2:209587425-209587447 AGCAACCTGCATCCCTCTGAGGG + Intronic
946165766 2:217862960-217862982 GGCCACCTGGCTCCAGCTGTAGG - Intronic
946605442 2:221399380-221399402 GCCTTCCTGAATCCCCCTGAGGG - Intergenic
948438449 2:237969381-237969403 GGCCACATGCAGCTCCCTGAAGG - Intronic
948479003 2:238239028-238239050 GGCCACCTAGAGCCCCTGGACGG - Exonic
948776201 2:240290222-240290244 GGCCAGCTGGATCCCACGGGCGG + Intergenic
948913576 2:241018782-241018804 GGCCACCTGGGTTCTCCTGTGGG - Intronic
1170665803 20:18384959-18384981 GGCCACAGGGATCTCCCTAATGG - Intronic
1171887398 20:30667650-30667672 GGCCACGTGGATCAGTCTGAGGG + Intergenic
1172882910 20:38213300-38213322 GGCCTCCTGGGCCCCCCAGAGGG - Exonic
1174507492 20:51025984-51026006 GTGCATCTGAATCCCCCTGAGGG + Intergenic
1175465839 20:59191085-59191107 GGCCACCTGGGGCCCCTGGAGGG - Exonic
1175964871 20:62655458-62655480 AGCCACCTGGGTTCCCCAGAAGG + Intronic
1176358502 21:5973040-5973062 GGCCGTCTGGATCTCCCTGGAGG + Exonic
1179765016 21:43565510-43565532 GGCCGTCTGGATCTCCCTGGAGG - Intronic
1181965418 22:26653176-26653198 GACCAGCTGAATCCCCCAGAAGG + Intergenic
1183270947 22:36862332-36862354 GGCCACGTGGACTCCCCTGTAGG - Intronic
1185317431 22:50185184-50185206 GGCCAGCCGGGTCCCCCTGGAGG + Intergenic
954135244 3:48579389-48579411 GGACACCTGGGTCCCCCTGGAGG + Exonic
960135761 3:114103336-114103358 GGCCGTCTGGATCTCCCTGGAGG + Intergenic
960949251 3:122988436-122988458 AACCACCTGGATCCCACTGGAGG + Intronic
961101360 3:124201949-124201971 GGCCAGCTGGAGCCCTGTGATGG + Intronic
961324998 3:126104581-126104603 GGCCTCATGGATTCCCCTGGTGG + Intronic
961623069 3:128239881-128239903 GGCCACCTGGTCCCCACTGGAGG + Intronic
962241667 3:133755588-133755610 GGCCACCTCGATGCCCCTGTAGG - Intronic
964396578 3:156252119-156252141 AAGCACCTGGCTCCCCCTGACGG + Intronic
964577407 3:158188406-158188428 AGCCACCTTGATCTACCTGAAGG + Intronic
964802076 3:160567856-160567878 GGACTTCTGGATCACCCTGATGG - Intergenic
964949471 3:162271234-162271256 GGTCACCTGGAACCTCCAGAGGG + Intergenic
967254297 3:187574004-187574026 GGCCACCTGGATCAGCCTTGGGG + Intergenic
967977632 3:195044384-195044406 GGCCACCTTGCTCTCCCTGGAGG + Intergenic
1202738034 3_GL000221v1_random:26474-26496 GGCCACGTGGATCAGTCTGATGG - Intergenic
968607809 4:1543764-1543786 GGCAACCTGGGTCCCTCTGTGGG + Intergenic
968704210 4:2070454-2070476 GGGCACCTGGCTCCCCCAGGGGG + Intergenic
970978469 4:22069791-22069813 GGCAATCTGGCTCCTCCTGATGG - Intergenic
973384034 4:49491440-49491462 GGCCACGTGGATCAGTCTGACGG + Intergenic
976779872 4:88747215-88747237 AGCCACCTGGATCTCCCTCACGG + Intronic
981170833 4:141621327-141621349 GACCACGTGGGTCCCACTGAGGG - Intergenic
981347775 4:143696887-143696909 GGCCTCCTGGATCTCCTTGAGGG + Exonic
984627264 4:182021203-182021225 AGCCACATGGATGCCCCTGGAGG - Intergenic
1202767887 4_GL000008v2_random:166771-166793 GGCCACGTGGATCAGTCTGACGG + Intergenic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
991044089 5:62204935-62204957 GGCCACCGGGAACCCACTGGTGG - Intergenic
991619367 5:68529628-68529650 GGCCTCATGGATCCTTCTGAAGG - Intergenic
994087893 5:95780267-95780289 GGCCACCAGGATGGCCCTGTGGG - Exonic
999209874 5:149878628-149878650 GGCCACCTCGTTCCCCATGCGGG - Intronic
1002492600 5:179589811-179589833 GACCACCTGGATCCCTTGGACGG + Intronic
1002495052 5:179606189-179606211 CGCCACCTGCTTCCCCCTTAGGG - Intronic
1002543952 5:179925942-179925964 TGCCACATGCATCCCCCTGTTGG - Intronic
1005428776 6:25731870-25731892 GGCCGTCTGGATCTCCCTGGAGG + Intergenic
1005466792 6:26123611-26123633 GGCCGTCTGGATCTCCCTGGAGG + Exonic
1005470570 6:26158441-26158463 GGCCGTCTGGATCTCCCTGGAGG - Exonic
1005473397 6:26184067-26184089 GGCCGTCTGGATCTCCCTGGAGG - Exonic
1005475081 6:26199830-26199852 GGCCGTCTGGATCTCCCTGGAGG - Exonic
1005569635 6:27132457-27132479 GGCCGTCTGGATCTCCCTGGAGG + Exonic
1005571099 6:27146505-27146527 GGCCGTCTGGATCTCCCTGGAGG + Exonic
1005646001 6:27838933-27838955 GGCCGTCTGGATCTCCCTGGAGG - Exonic
1005652057 6:27893734-27893756 GGCCGTCTGGATCTCCCTGGAGG - Exonic
1006474748 6:34246706-34246728 TGTCACCTGGCTCCCCCTGCTGG - Exonic
1006515905 6:34545405-34545427 GGCCAGATGGTTCCCCCGGAGGG - Intronic
1006725670 6:36197296-36197318 GGTCCCCTGGGTCCCTCTGACGG + Intronic
1007780848 6:44253678-44253700 TCCCACCTGGCTCCCCCTGCTGG + Exonic
1008111681 6:47501987-47502009 GGCCAGCTGGATCCTCTTCAAGG + Intronic
1010958875 6:82123033-82123055 AGCCACCTGAATCCCCCAGTAGG + Intergenic
1013196388 6:107848393-107848415 GGCCACCTCGCGCCCCCTGGTGG + Intergenic
1019132024 6:169883823-169883845 GACCACCAGGGTCCCCCAGAAGG + Intergenic
1019346288 7:532334-532356 GGGCAGCTGGATCCTCCTGCAGG - Intergenic
1019426989 7:982612-982634 CACCACCTGCATCTCCCTGAGGG - Intergenic
1019481060 7:1267078-1267100 GCCCACCTGGAGCCACATGAAGG - Intergenic
1019634991 7:2070750-2070772 AGCCTCCTGGCTCTCCCTGATGG - Intronic
1020268290 7:6576606-6576628 GGCCACCTGGATCCCCCTGCTGG + Intergenic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1022765022 7:33402191-33402213 GGCAACAGGGATCCCCTTGAAGG - Intronic
1023995066 7:45154781-45154803 GGGCACCTGGCTCCCCCTGCTGG - Intergenic
1024022993 7:45387897-45387919 AGACACCTGGATGCTCCTGAGGG + Intergenic
1024148588 7:46543469-46543491 GGCCACAGGGGTCTCCCTGAGGG + Intergenic
1024208415 7:47183238-47183260 TGCCACCTGGCTCTCCCTGTTGG + Intergenic
1031026551 7:116685987-116686009 GGCCACCAGGGTCCCCCTCCTGG + Intronic
1031977351 7:128102525-128102547 GCCCACCTGGTTCCCACAGAGGG + Intergenic
1032540006 7:132695048-132695070 GGTCTGGTGGATCCCCCTGAGGG + Intronic
1032720906 7:134550260-134550282 GGCCACTTGGATTTCCCTAAAGG - Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1035301053 7:157897355-157897377 AGCCACCTGCATCCCACGGAAGG - Intronic
1041780979 8:61578224-61578246 GGACTTCTGGATCACCCTGATGG - Intronic
1042485505 8:69341945-69341967 GGCCACCTTGTTCCTCCTGGAGG + Intergenic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1043309490 8:78840599-78840621 GGCCACTTGGCTCCCCCCGGAGG + Intergenic
1049755521 8:144309755-144309777 GGACACCTGGATTCCCGAGAGGG - Exonic
1054362051 9:64132382-64132404 GGCCACATGGATCAGTCTGAGGG - Intergenic
1056201232 9:84278723-84278745 GACAGCCTGGATCCCCTTGAAGG + Intronic
1057214203 9:93219098-93219120 GGGCACCTGGATGTCCCTGGAGG + Intronic
1057841396 9:98488071-98488093 GGCCACCTGCATCCCTCAGCTGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1062136388 9:134930662-134930684 GGCCACCTGGGTCACCCAGTAGG - Intergenic
1203692297 Un_GL000214v1:55693-55715 GGCCACGTGGATCAGTCTGACGG + Intergenic
1203643998 Un_KI270751v1:48498-48520 GGCCACGTGGATCAGTCTGACGG - Intergenic
1185802306 X:3024095-3024117 GGCCACCTGGAGCCCCTGGACGG + Exonic
1186411991 X:9352030-9352052 GGCCACAGGGATCCACCTGCTGG + Intergenic
1189278201 X:39802749-39802771 GGGAACCTGGAACCCCCTGACGG + Intergenic
1190010436 X:46780184-46780206 CACCACCCGGATCCCCCTCAAGG + Intergenic
1193590489 X:83383653-83383675 GGCCACATGGATCCCCATCATGG + Intergenic
1195883777 X:109619477-109619499 GGCCACCTCCATCCCCCCCAGGG + Intergenic
1196120031 X:112040012-112040034 GGCCATCTGGTCCCCCATGAAGG - Intronic
1199114791 X:143978548-143978570 GGATACCTGGATCCCCCAGGGGG + Intergenic
1200141774 X:153906121-153906143 TGTCACCTGGATTGCCCTGATGG + Exonic
1200204424 X:154305573-154305595 GGCCACTTGGAGCCCTGTGATGG + Intronic