ID: 904608889

View in Genome Browser
Species Human (GRCh38)
Location 1:31714614-31714636
Sequence GGCGGTGCCGGCGGGGCAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904608889_904608902 12 Left 904608889 1:31714614-31714636 CCGCTTGCCCCGCCGGCACCGCC No data
Right 904608902 1:31714649-31714671 CAGAGTCGGGCCAGCAGAGCCGG No data
904608889_904608898 -2 Left 904608889 1:31714614-31714636 CCGCTTGCCCCGCCGGCACCGCC No data
Right 904608898 1:31714635-31714657 CCCTGCCAAGGGCGCAGAGTCGG No data
904608889_904608905 24 Left 904608889 1:31714614-31714636 CCGCTTGCCCCGCCGGCACCGCC No data
Right 904608905 1:31714661-31714683 AGCAGAGCCGGAGTGATGCCGGG No data
904608889_904608900 -1 Left 904608889 1:31714614-31714636 CCGCTTGCCCCGCCGGCACCGCC No data
Right 904608900 1:31714636-31714658 CCTGCCAAGGGCGCAGAGTCGGG No data
904608889_904608904 23 Left 904608889 1:31714614-31714636 CCGCTTGCCCCGCCGGCACCGCC No data
Right 904608904 1:31714660-31714682 CAGCAGAGCCGGAGTGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904608889 Original CRISPR GGCGGTGCCGGCGGGGCAAG CGG (reversed) Intergenic