ID: 904609060

View in Genome Browser
Species Human (GRCh38)
Location 1:31715217-31715239
Sequence GCTGGAGGCGTGGCTGTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904609060_904609066 -2 Left 904609060 1:31715217-31715239 CCGCCGACAGCCACGCCTCCAGC No data
Right 904609066 1:31715238-31715260 GCCCACTCTGGCCACGCCACTGG No data
904609060_904609075 27 Left 904609060 1:31715217-31715239 CCGCCGACAGCCACGCCTCCAGC No data
Right 904609075 1:31715267-31715289 TTTGGACCACACTCATGGCCGGG No data
904609060_904609074 26 Left 904609060 1:31715217-31715239 CCGCCGACAGCCACGCCTCCAGC No data
Right 904609074 1:31715266-31715288 CTTTGGACCACACTCATGGCCGG No data
904609060_904609070 9 Left 904609060 1:31715217-31715239 CCGCCGACAGCCACGCCTCCAGC No data
Right 904609070 1:31715249-31715271 CCACGCCACTGGTCTGCCTTTGG No data
904609060_904609072 22 Left 904609060 1:31715217-31715239 CCGCCGACAGCCACGCCTCCAGC No data
Right 904609072 1:31715262-31715284 CTGCCTTTGGACCACACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904609060 Original CRISPR GCTGGAGGCGTGGCTGTCGG CGG (reversed) Intergenic