ID: 904612694

View in Genome Browser
Species Human (GRCh38)
Location 1:31734019-31734041
Sequence TCCGCAGAGACAGCCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904612683_904612694 27 Left 904612683 1:31733969-31733991 CCAGTGGGAGAGTCAGGCACAGC 0: 1
1: 0
2: 0
3: 40
4: 267
Right 904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 163
904612682_904612694 28 Left 904612682 1:31733968-31733990 CCCAGTGGGAGAGTCAGGCACAG 0: 1
1: 0
2: 5
3: 31
4: 266
Right 904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 163
904612681_904612694 29 Left 904612681 1:31733967-31733989 CCCCAGTGGGAGAGTCAGGCACA 0: 1
1: 0
2: 2
3: 30
4: 218
Right 904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 163
904612680_904612694 30 Left 904612680 1:31733966-31733988 CCCCCAGTGGGAGAGTCAGGCAC 0: 1
1: 0
2: 1
3: 21
4: 173
Right 904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904612694 Original CRISPR TCCGCAGAGACAGCCGGGGG AGG Intronic
900176653 1:1294128-1294150 ACCAAAGAGACAGCCGGGGCCGG - Exonic
900387416 1:2416910-2416932 ACAGCAGAGCCAGCCTGGGGGGG + Intergenic
901686327 1:10945604-10945626 ACCGCAGAAAGAGCTGGGGGTGG - Intergenic
904421821 1:30399005-30399027 TCTGCAGAGAGAGATGGGGGTGG + Intergenic
904457975 1:30658585-30658607 TCTGGAGAGACAGCAGGGAGGGG + Intergenic
904612694 1:31734019-31734041 TCCGCAGAGACAGCCGGGGGAGG + Intronic
905086801 1:35387087-35387109 TCCACAGTGTCAGCCGGAGGAGG + Exonic
905129977 1:35747030-35747052 TCCTCAGAGAGGGCCGGGTGCGG + Intronic
905402903 1:37716295-37716317 TCTGCAGAAACAGCTGGGGTAGG + Exonic
905410515 1:37765142-37765164 ACCCCAGAGCCAGCGGGGGGCGG + Intergenic
908700030 1:66888999-66889021 TCTACAGAGAAAGCTGGGGGAGG + Intronic
909400652 1:75225898-75225920 TCTTATGAGACAGCCGGGGGTGG + Intronic
919792183 1:201299157-201299179 TGCCCAGAGACAGCCCGGAGTGG + Intronic
920079753 1:203364280-203364302 TCCACTGAGGCAGCCAGGGGCGG + Intergenic
920648679 1:207821293-207821315 TCCGCAGAGTGGGCGGGGGGCGG - Intergenic
1063203251 10:3806214-3806236 ACCTCAGAGACAGCCTGGGATGG - Intergenic
1065588863 10:27245965-27245987 TCCACAGAGGCAGCCGGCGGAGG - Intergenic
1069719639 10:70541335-70541357 GGGGCAGAGACAGCCGGGTGTGG + Intronic
1069721045 10:70549560-70549582 TCCTCAGAGACAGCCTGGGAAGG + Intronic
1070677375 10:78421230-78421252 CCTGCCGAGACAGCCGGGGGAGG - Intergenic
1071415999 10:85441829-85441851 GATGCAGAGACAGCAGGGGGTGG - Intergenic
1071454717 10:85837092-85837114 TCTGCAGTGACAGTCGGTGGTGG - Intronic
1073250835 10:102119639-102119661 TCCTCAGAAACAGCATGGGGGGG + Intronic
1075871502 10:125774840-125774862 ACCGCAGAGAAAGCCATGGGAGG + Intronic
1076727847 10:132421690-132421712 TCCGCAGAGAGAGGCGGGTGAGG + Intergenic
1077947024 11:6911086-6911108 TCCTCTGAGACACCCTGGGGGGG - Intergenic
1078003140 11:7513694-7513716 TCCGCCGAGAGAGGCGGGGCTGG + Intronic
1078025379 11:7690045-7690067 TCCACAAAGACAGCCAGGGTTGG + Intronic
1078660777 11:13283832-13283854 GCTGCAGAGAAAGCAGGGGGAGG - Intronic
1083572888 11:63769357-63769379 TCCCCCGAGCCAGCCAGGGGTGG + Intergenic
1083997319 11:66278727-66278749 TACACACAGACAGGCGGGGGCGG - Intronic
1088606952 11:111541347-111541369 GCCGCAGAGACAGCGGGGTAGGG + Intronic
1093340432 12:17967169-17967191 TCCTCAGAGCCAGCAGTGGGGGG + Intergenic
1096621696 12:52869448-52869470 GCAGCAGAGACAGCAGGGGAGGG + Intergenic
1097102854 12:56601589-56601611 TCCTCAGAAACTGCAGGGGGCGG + Exonic
1100606055 12:96152974-96152996 TCCACAGACACGGCCGGGCGCGG - Intergenic
1101789118 12:107911949-107911971 TCCGGAGGGGCAGCCGGGAGAGG + Intergenic
1101832544 12:108270659-108270681 TCTGCAGAGACAGCCAGGCCTGG - Intergenic
1103699921 12:122843778-122843800 TCCGCAGAGACAGCAGAGAGGGG - Intronic
1104966263 12:132509972-132509994 GCAGCAGCGACCGCCGGGGGCGG - Intronic
1104977671 12:132559568-132559590 TTCGTAGAGACGGGCGGGGGTGG + Intronic
1112520839 13:100093745-100093767 TTTGTAGAGATAGCCGGGGGTGG - Intronic
1112805139 13:103156519-103156541 TGGGTAGAGACAGCCGTGGGTGG + Intergenic
1113921813 13:113917596-113917618 CCCGCAGAGACAGCAGGCAGGGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119260931 14:73237728-73237750 TCCGGAGAGCGAGCCGGGGCGGG - Intronic
1119743310 14:77027819-77027841 GCCGCGGAGACAGCCCGGGCGGG - Exonic
1121052998 14:90831516-90831538 TCCGCAAAGGCAGCAGGGGCGGG - Intergenic
1122584414 14:102795197-102795219 TCAGCTGAGACAGGCTGGGGAGG - Intronic
1123986049 15:25647268-25647290 TCCCCACAGACAGCTGGGGCGGG - Intergenic
1127282872 15:57506598-57506620 TCCCCAGAGCCAGCCAGGGAAGG - Intronic
1127417531 15:58771726-58771748 TCCCCGGAGACAGCCGTGGCCGG + Exonic
1130139950 15:81216583-81216605 TCCTCAAAGACAGCAGGAGGCGG - Intronic
1132544016 16:524828-524850 TCAGCAGAGGCAGGCTGGGGCGG - Intergenic
1134675572 16:16087747-16087769 TCAGCAGAAACAGCCGGGTGTGG - Intronic
1138546138 16:57721032-57721054 TTAGTAGAGACGGCCGGGGGAGG - Intronic
1139279321 16:65756287-65756309 TCCGTAGTGACTGGCGGGGGAGG - Intergenic
1140426188 16:74863708-74863730 ACCGCAGCCACAGCCGGGCGCGG - Intergenic
1141065602 16:80911289-80911311 TAAGAAGAGACAGCCGGGCGTGG + Intergenic
1141598256 16:85110445-85110467 TCCACAGGGACAGCCAGGTGAGG - Exonic
1142077865 16:88130915-88130937 TCGGCAGAGACAGGCGGAAGTGG + Intergenic
1142406356 16:89892361-89892383 TCTGCAGAGGCTGCTGGGGGTGG + Intronic
1142585126 17:967358-967380 GGCGCAGAGACAGGCGGGGCGGG + Intronic
1145265456 17:21377643-21377665 TGGGCAGAGACAGCTGGGGTGGG + Intronic
1145846332 17:28041968-28041990 TCAGCAGAAGCAGCCGGCGGCGG + Intronic
1146595526 17:34165177-34165199 TCCCCAGAGACTCCTGGGGGTGG + Intronic
1147158783 17:38559034-38559056 TTAGCAGAGACAGGCTGGGGAGG - Intronic
1152550738 17:81028706-81028728 GCCGCAGCCACAGACGGGGGAGG + Intergenic
1152742005 17:82022569-82022591 TCTGCAGAAACAGGCAGGGGTGG - Intronic
1154218165 18:12431128-12431150 TCTGCAGAGACACCAGGGGTCGG - Exonic
1157816022 18:50729893-50729915 CCCCCAGAGAAAGCCGGGGCTGG + Exonic
1159704997 18:71675218-71675240 TCCACAGAGCCAGCAGGGGCTGG - Intergenic
1160149567 18:76388830-76388852 TCCTCAGCAACAGCCGGGGAAGG + Intronic
1160893590 19:1392489-1392511 TCCACAGAGACAGGGAGGGGAGG - Intronic
1160961475 19:1723586-1723608 TCCACAGAGACAGGAGGGGATGG + Intergenic
1161171361 19:2813926-2813948 TGCGCACAGGCAGCCGGGGCGGG + Exonic
1161283546 19:3457885-3457907 TCCGCAAAACCAGCCGGAGGAGG + Intronic
1161885523 19:6991726-6991748 TCCACAATGTCAGCCGGGGGCGG - Intergenic
1167390245 19:49190195-49190217 TCAGCAGAGACTGTGGGGGGTGG - Exonic
1167439431 19:49499918-49499940 TCCCCAGAGACCGGAGGGGGCGG - Intergenic
1168650963 19:58091840-58091862 TCCACAGAGACAGCTGGAAGGGG + Intronic
926052502 2:9753890-9753912 ACAGCAGAGGCAGCCGTGGGAGG + Intergenic
927904560 2:26847758-26847780 TCCCCAGGGAGGGCCGGGGGCGG - Intronic
937319269 2:120951301-120951323 TCCCCAGGGCCAGCCGGGTGCGG - Exonic
940056111 2:149514151-149514173 TCCTGAGACACAGCCTGGGGTGG + Intergenic
946164729 2:217857135-217857157 GCAGCAGAGGCAGCCGTGGGTGG - Intronic
947831232 2:233143334-233143356 TCCAAAGAGAGAGCCGGTGGGGG + Intronic
948482467 2:238258828-238258850 TCCACAGAGAGACCTGGGGGGGG + Intronic
948869892 2:240792506-240792528 ACGACAGAGACAGCGGGGGGAGG + Intronic
1169016891 20:2299443-2299465 TCTGCAGAGACAGCCCTGCGGGG - Intronic
1171206078 20:23282623-23282645 TCCCCAGAAACAGGAGGGGGAGG + Intergenic
1172777177 20:37414553-37414575 CCCTCAGAGACAGCGAGGGGAGG - Intergenic
1172961859 20:38805739-38805761 CCCACAGACACAGCCGGGGTCGG + Exonic
1175521143 20:59603707-59603729 ACCACAGAGACACCTGGGGGAGG - Intronic
1175625578 20:60486062-60486084 CCAGCAGAGGCAGCTGGGGGTGG + Intergenic
1175895289 20:62333286-62333308 TCCCCAGAGACAGCCTGAGTGGG + Intronic
1179937695 21:44615625-44615647 CCTGCAGAGAGACCCGGGGGAGG - Intronic
1181935210 22:26433534-26433556 TCCTCAGATACTGCCAGGGGCGG - Exonic
1183062569 22:35345236-35345258 TCTGCAGAGACACCAGGGGATGG + Intronic
1183474198 22:38026876-38026898 GCCTCAGAGGCAGCCGGGGTAGG - Intronic
1183962225 22:41418343-41418365 TCTGCAGAGACAGCAGGGCTTGG - Intergenic
1184376632 22:44117480-44117502 CTCGCAGAGAGAGCCCGGGGTGG + Intronic
1185050956 22:48553702-48553724 CCCGGAGAGAGAGCCGTGGGAGG - Intronic
950264688 3:11564974-11564996 GCCGCAGAGACCCCCGGGAGCGG - Exonic
953724793 3:45388530-45388552 TCGACACAGACAGACGGGGGCGG - Intronic
959888260 3:111526757-111526779 TCCTCAGAGACAGGCTGTGGTGG + Intronic
964984461 3:162722942-162722964 TCAGCAAAGACAGACAGGGGTGG + Intergenic
965360828 3:167735615-167735637 GCTGCAGAAACAGCAGGGGGAGG + Intronic
966912964 3:184569472-184569494 CCCACAGAGACAGGCGGGGAGGG - Intronic
967721460 3:192820643-192820665 TTTGCAGAGAGAGCCCGGGGCGG - Intronic
968471234 4:783355-783377 TCCCCAGAGGCAGCAGGAGGAGG + Intergenic
968648206 4:1750171-1750193 TCTGCAGAGAGAGGAGGGGGCGG + Intergenic
968914988 4:3493436-3493458 GCCGAAAAGAAAGCCGGGGGTGG - Exonic
969604866 4:8197436-8197458 TCCTCAGACGCAGCCGGGGCTGG + Intronic
984526774 4:180867030-180867052 TCGGCAGGGACAGCCTGGGTGGG - Intergenic
984585967 4:181564641-181564663 TCCACTGAGACAGATGGGGGAGG - Intergenic
984699337 4:182808337-182808359 TCGGCAGAGCCAGCCTGAGGGGG - Intergenic
984928342 4:184825937-184825959 GCTGCAGTGACAGCCGGCGGCGG - Intronic
986298791 5:6462096-6462118 GCCACAGAGACAGCATGGGGTGG - Intronic
991950205 5:71939737-71939759 TCCTCAGAGATTGCCTGGGGTGG - Intergenic
995145907 5:108787019-108787041 TCTGCAGAGCCAGCAGGGGCTGG + Intronic
1002536034 5:179876044-179876066 GGCACAGAGACAGCCGGGGAAGG + Intronic
1006033923 6:31197510-31197532 TCTGCAGTGACAGCCGAGCGCGG - Intergenic
1006388068 6:33743062-33743084 TCTGCAGAGGCAGCCGGCAGTGG + Intronic
1007770283 6:44186552-44186574 TCCCCAGAGAGAGCAGGGAGAGG + Intergenic
1008623846 6:53298689-53298711 GAAGCAGAGACAGCCGTGGGTGG - Intronic
1010559540 6:77333073-77333095 TCCGCAGAGCCAGCAGGGGCTGG + Intergenic
1017805510 6:157942379-157942401 TCAGCAGTGACAGCAGGGTGTGG + Intronic
1018298901 6:162378882-162378904 TCTGCAGAGACAGCCAAGTGTGG - Intronic
1019352918 7:563330-563352 TCTGCAGAGGCAGCCTGTGGAGG - Intronic
1019359815 7:598942-598964 TCCACAGAGCCAGCCCGGGACGG + Intronic
1019362335 7:611345-611367 TGCCCAGAGAGAGCTGGGGGTGG - Intronic
1019502163 7:1369732-1369754 TCGGCTGAGACAGCCTGGGTGGG - Intergenic
1019936672 7:4262624-4262646 TCCACAGAGACCTCCGAGGGTGG - Intronic
1020011762 7:4809185-4809207 TCGGCAGTGACAGCCCGGGGAGG - Intronic
1021498415 7:21302175-21302197 TCTGCATAGACAGCTGGAGGAGG - Intergenic
1024270977 7:47641260-47641282 TGCTGAGAGACAGCAGGGGGTGG - Intergenic
1033643410 7:143283926-143283948 TCCCCAGGGACAGCTGGGGTGGG - Intronic
1034259834 7:149748105-149748127 TCTGCAAAGAGAGCTGGGGGCGG + Intergenic
1034383529 7:150719707-150719729 TCCCCAGAGACAGGCAGTGGGGG - Intronic
1036561612 8:9904024-9904046 TCGGCAGCGGCAGCCGGGGCAGG + Intergenic
1036701310 8:11015707-11015729 GGAGCAGAGAAAGCCGGGGGCGG + Intronic
1037532399 8:19790629-19790651 ACATCAGAGACAGCAGGGGGAGG + Intergenic
1039060008 8:33565804-33565826 ACCCCAGGGACAGCCGGGCGCGG + Intronic
1039608422 8:38901177-38901199 TCCGCGGAGCCCGCCGGGGAGGG - Intergenic
1039737031 8:40343817-40343839 TCAGAAGAGTCAGCTGGGGGTGG - Intergenic
1043666753 8:82825133-82825155 TCCACAGAGCCAGCCAGGGTGGG + Intergenic
1049104464 8:140603291-140603313 TCCGCAAACACAGCCCGGTGTGG - Intronic
1049628230 8:143636234-143636256 TCCGCCGAGAGGGCCGGGCGGGG + Intronic
1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG + Intronic
1049845483 8:144798910-144798932 GCCGCCGAGACAGCGCGGGGAGG - Exonic
1053472840 9:38359148-38359170 TCTACAGAGCCAGCCGGGGGTGG + Intergenic
1055611947 9:78032144-78032166 TCCGCAGAGCCCGCGGGGGCCGG - Intergenic
1056681646 9:88724637-88724659 CCAGCAGAGACGGCCAGGGGAGG + Intergenic
1057239184 9:93393063-93393085 TCCCCATACCCAGCCGGGGGAGG + Intergenic
1057999410 9:99849905-99849927 TGCTCAGAGACAGCAGGTGGGGG + Intronic
1058023688 9:100117526-100117548 TCCGCAGTGGCATCCGGGGCCGG - Intronic
1058690249 9:107514306-107514328 TTTGTAGAGACAGCAGGGGGAGG - Intergenic
1059004183 9:110383684-110383706 TCCTCAGAGCCAGCAGGGGAAGG + Intronic
1059386151 9:113966003-113966025 GTCGCAGAGCCAGCCTGGGGTGG - Intronic
1059451198 9:114372408-114372430 GCCACAGTGACAGGCGGGGGTGG - Intronic
1060796982 9:126519196-126519218 TCCGCGGTGGCTGCCGGGGGAGG - Intergenic
1061109573 9:128559102-128559124 TCCCCAGAGACAGCCTGTTGTGG + Intronic
1061485306 9:130917597-130917619 TCTGCAGAGGCAGCCCTGGGCGG - Intronic
1061933067 9:133843235-133843257 CACGCAGAGACAGCTCGGGGTGG + Intronic
1186871559 X:13779035-13779057 TTGGCAGAAACAACCGGGGGTGG - Intronic
1192172930 X:68867944-68867966 TTCGCAGTGACAGCAGGGAGTGG - Intergenic
1193417343 X:81240872-81240894 TCCGCAGAGCCAGTGGGGGCTGG + Intronic
1197594533 X:128450201-128450223 TTCCCAGAGACGGCCGGGCGCGG - Intergenic
1199978629 X:152908801-152908823 TCAGCAGAGTCAGCCAGGAGTGG - Intergenic
1200122108 X:153796025-153796047 TCAGCAGAGACATCGGGGGTGGG - Intronic
1200695581 Y:6355849-6355871 TCTGCAGAGAAAGCCAGGGTGGG - Intergenic
1201039696 Y:9818861-9818883 TCTGCAGAGAAAGCCAGGGTGGG + Intergenic