ID: 904614532

View in Genome Browser
Species Human (GRCh38)
Location 1:31742794-31742816
Sequence CGGGCTGGGCAGCGCCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 204}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904614513_904614532 30 Left 904614513 1:31742741-31742763 CCAGGGGCAGGTCACTGGACCTG 0: 1
1: 0
2: 3
3: 64
4: 452
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204
904614516_904614532 3 Left 904614516 1:31742768-31742790 CCTCCCCAGGTCTCCCGACCCCC 0: 1
1: 0
2: 2
3: 66
4: 630
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204
904614524_904614532 -10 Left 904614524 1:31742781-31742803 CCCGACCCCCCACCGGGCTGGGC 0: 1
1: 0
2: 2
3: 30
4: 277
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204
904614518_904614532 -1 Left 904614518 1:31742772-31742794 CCCAGGTCTCCCGACCCCCCACC 0: 1
1: 0
2: 3
3: 34
4: 402
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204
904614519_904614532 -2 Left 904614519 1:31742773-31742795 CCAGGTCTCCCGACCCCCCACCG 0: 1
1: 0
2: 2
3: 18
4: 271
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204
904614515_904614532 11 Left 904614515 1:31742760-31742782 CCTGACTGCCTCCCCAGGTCTCC 0: 1
1: 0
2: 3
3: 56
4: 498
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204
904614517_904614532 0 Left 904614517 1:31742771-31742793 CCCCAGGTCTCCCGACCCCCCAC 0: 1
1: 0
2: 0
3: 27
4: 354
Right 904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG 0: 1
1: 0
2: 0
3: 30
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904614532 Original CRISPR CGGGCTGGGCAGCGCCCTCA TGG Intronic
900246684 1:1639554-1639576 CGGCCTGGGCACCGGCCCCAAGG - Intronic
900257906 1:1706686-1706708 CGGCCTGGGCACCGGCCCCAAGG - Intronic
900646366 1:3710456-3710478 AGGGCTGGGCAGCACCCGCATGG - Intronic
901109436 1:6784269-6784291 GTGGCTGGGCAGCGCTCCCAGGG - Intergenic
901490631 1:9594683-9594705 CGGGCTGGCCAGGGGCCTGAGGG - Intronic
901647532 1:10724708-10724730 CTGGCTGGGCAGTGCCCTTGGGG - Intronic
901753866 1:11429089-11429111 CGTTCTGGGCAGCTGCCTCAGGG - Intergenic
902837268 1:19054986-19055008 TGAGCTGGCCAGCGCCCCCAGGG - Intergenic
903332126 1:22601636-22601658 CGCCCTGGGCATCACCCTCATGG + Exonic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG + Intronic
904771802 1:32885068-32885090 TGGGCTGGGAAGGGCCCTCTGGG + Intergenic
905670662 1:39788465-39788487 CGGGCCGGGGAGCGCGGTCATGG + Exonic
905890799 1:41517146-41517168 GGGGCAGGGCAGGGACCTCAGGG + Intronic
908003286 1:59702826-59702848 CCAGCTGGGCAGCTTCCTCATGG + Intronic
911450471 1:98054366-98054388 CGGGCTGGGCAGAGCCCGCGGGG - Intergenic
912385337 1:109268589-109268611 GCGGGTGGGCAGCGCCCTCCTGG + Exonic
913942325 1:125119855-125119877 CGGGCTGGACATCTCCCTCTGGG + Intergenic
919277468 1:195439641-195439663 CTGCATGGGCAGAGCCCTCATGG - Intergenic
919848154 1:201654589-201654611 CAGGCTGAGCAGAGCCCTCAGGG + Intronic
920385738 1:205569261-205569283 CCTGCTGGGCAGCGCCCTCGGGG + Exonic
922602924 1:226870727-226870749 AGGGCAGGGCAGGGCCCTCAGGG - Intronic
923305091 1:232681481-232681503 CTGGCTGGGCAGCTCCCTTGGGG - Intergenic
1062848487 10:725921-725943 AGGCTTGGGCAGCGCCCACAGGG - Intergenic
1063407754 10:5813213-5813235 CGTGCTGGGCACCGGCCTGACGG - Exonic
1063429652 10:5977525-5977547 CGGCCTGGGCAGCGCTCGCCCGG - Exonic
1064265405 10:13821432-13821454 CAGGCTGGGCAGGGACCTCTGGG - Intronic
1065872079 10:29964259-29964281 AGGCCTGGGCATTGCCCTCATGG + Intergenic
1066650614 10:37651586-37651608 GGGGCAGCGCAGCGCCCTCCAGG + Intergenic
1069892504 10:71661134-71661156 GGGGCAGTGCAGCCCCCTCATGG + Intronic
1072734277 10:97868517-97868539 GGGGCTGGGCAGTCCCCTCTGGG + Exonic
1073795849 10:106987569-106987591 CGGACCGGGCAGTGCCCTCAGGG + Intronic
1075805730 10:125187556-125187578 CTGGCTGAGCAGTGACCTCAAGG - Intergenic
1076401548 10:130188742-130188764 CGGGCAGGGCATGGCCTTCACGG - Intergenic
1077313866 11:1907031-1907053 CGGGCTGGGAATTGGCCTCAGGG - Intergenic
1078821983 11:14891912-14891934 CGGGCTGGCCAGGGCCTTCCTGG - Intronic
1079135994 11:17776329-17776351 CCAGCTGGGCAGATCCCTCAGGG + Intronic
1079308439 11:19344823-19344845 CAGGCTGGACAGCTCCCTGATGG + Intergenic
1080675556 11:34423522-34423544 AGGGCTTGGCAGGGCACTCAAGG + Intergenic
1081106639 11:39078634-39078656 GGGGCTGGGCACCGCGCTCAGGG + Intergenic
1081542818 11:44048557-44048579 GGGGGTGGGCAGCATCCTCACGG + Intronic
1083222810 11:61264625-61264647 TGCCCTGGGCAGTGCCCTCAAGG + Intronic
1083298489 11:61727949-61727971 AGCCCTGGGCAGGGCCCTCAGGG + Intronic
1083612048 11:64008890-64008912 CGGCCTGGCCAGCGCCCCAAAGG - Intronic
1083811575 11:65109547-65109569 ATGGCTGGACAGTGCCCTCATGG + Intronic
1083886453 11:65575804-65575826 CGGCCCGGGCAGCGCTCTCTAGG + Intergenic
1084521824 11:69667820-69667842 CAGGCGGGGCAGCGCACTCCCGG - Intronic
1085643943 11:78210456-78210478 CAGGGCGGGCAGCGCCCTCACGG - Exonic
1087046950 11:93850482-93850504 CCCGCTGGGCAGAGGCCTCATGG + Exonic
1089495675 11:118907701-118907723 TGGCCTGGGCAGTGCCCTCTAGG - Intronic
1089792372 11:120954143-120954165 CAGTCTGGGAAGTGCCCTCAGGG - Intronic
1090372912 11:126269072-126269094 TGGGCGGGGCAGAGCCCTGAGGG + Intronic
1090635561 11:128688581-128688603 CAGGCTGGGCTCCTCCCTCATGG - Intronic
1090961925 11:131564925-131564947 CGGCCTGGGCAGTGCACACATGG - Intronic
1096115968 12:49055333-49055355 CCGACTGGGCAGGGCCCTCTCGG + Intronic
1096774003 12:53953201-53953223 CGGGCAGGGCGGCGCCCGCGGGG + Intergenic
1097272212 12:57783024-57783046 CGGGCAGGGAAGCGACCTTAGGG - Intronic
1098319848 12:69232244-69232266 CTGGAGGGGCAGAGCCCTCATGG + Intergenic
1101783822 12:107864355-107864377 CGGGCTGGGCGCCGCGCTCGAGG + Intergenic
1102035771 12:109769682-109769704 GGGGCAGGGCAGCCCCCCCAGGG + Exonic
1102962193 12:117099904-117099926 CGGGCTGTGCAGGGCCCACACGG - Intergenic
1105308528 13:19186115-19186137 CTGGCAGGGCAGCTCCCGCATGG - Intronic
1105593859 13:21817968-21817990 GGGGCTGTGCAGGGCACTCATGG + Intergenic
1106100372 13:26690130-26690152 CAGGCTGGGCCCTGCCCTCATGG + Intergenic
1112504646 13:99968648-99968670 CGGGCTGGGGAGCGGCTTCACGG + Intronic
1113378237 13:109783351-109783373 CAGGCTGGGCAGCCCCTCCAGGG + Exonic
1113713633 13:112488485-112488507 CAGGCTGGGCAGCTGTCTCAGGG + Intronic
1119506352 14:75176354-75176376 CGGCCTGCGCAGCCACCTCAAGG - Exonic
1121638389 14:95469031-95469053 TGGGCTGGGCAGCGTGCTCATGG - Intronic
1122122593 14:99562312-99562334 CTGGCTGGCCACTGCCCTCAGGG - Intronic
1122141601 14:99666359-99666381 CGGGCTTGGCAGCATCCGCAGGG + Intronic
1122779774 14:104138740-104138762 CGGGCTGCGCAGCGCACAGAGGG - Exonic
1122938361 14:104970253-104970275 CGGGCTGGGCAGGGATGTCAGGG - Intronic
1123110865 14:105866333-105866355 CGGGCTGGGTGGGGCCCTCAGGG + Intergenic
1202902438 14_GL000194v1_random:51435-51457 AGGGCTGGGCAGCGCCACCTGGG + Intergenic
1124080216 15:26487194-26487216 CGGGGTGGACAGTGCCATCAGGG - Intergenic
1124381796 15:29173278-29173300 GGGGCTAGGCAGCGGCCCCATGG - Intronic
1125434188 15:39627904-39627926 AGGGCTGGGCAGGGCTCTGAAGG + Intronic
1125903602 15:43370862-43370884 TGGGCTGGAGGGCGCCCTCAGGG - Intronic
1126823771 15:52529319-52529341 CGGGGTGTGCCGCGCCCTCGGGG - Intergenic
1127277327 15:57458744-57458766 GGGGCTGGGCAGCGGCAGCAGGG + Intronic
1129483142 15:75843543-75843565 CGGCCTGGGCCGCGCTCTCGCGG - Exonic
1131056731 15:89379280-89379302 CGGGGTGGGCAGCCCAGTCAGGG - Intergenic
1132715787 16:1289239-1289261 TGGGCGGGGCAGCCCCCTCCTGG + Intergenic
1132734286 16:1377884-1377906 CAGGCTGGGCATGGGCCTCAGGG - Intronic
1132747978 16:1444839-1444861 AGGCCTGGGCAGCGCCATCGGGG + Intergenic
1133006399 16:2883817-2883839 CGGGCTGGGCTGCGCCCAAATGG - Intronic
1133259324 16:4538254-4538276 AGGTCTCGGCAGCGCCCTGAGGG + Intronic
1134353950 16:13463686-13463708 CCAGTTTGGCAGCGCCCTCATGG + Intergenic
1135585879 16:23670507-23670529 ATGGCTGGGCAGCACCCTCTAGG - Exonic
1141558656 16:84852680-84852702 CGGGTTGGGAATCCCCCTCAAGG - Intronic
1143244063 17:5468380-5468402 CGGGCTGTCCAGCGCCTCCAGGG + Intronic
1143904529 17:10198441-10198463 CGGGCTGGGCAGCGGCTCCGCGG + Exonic
1144626214 17:16845656-16845678 TGGCCTGGGCAGCGCCCTCGGGG - Intergenic
1144880219 17:18427064-18427086 TGGCCTGGGCAGCGCCCTCGGGG + Intergenic
1145152016 17:20517320-20517342 TGGCCTGGGCAGCGCCCTCGGGG - Intergenic
1145970925 17:28956070-28956092 AGGGCTTGGCAGGACCCTCAGGG + Intronic
1146163387 17:30571591-30571613 TGGCCTGGGCAGTGCCCTCCGGG - Intergenic
1147580359 17:41624350-41624372 CGGCCTGGGCAGCACCCTCGGGG - Exonic
1151724897 17:75878131-75878153 CGGGCAGGGCCGCGCCCTCGGGG + Exonic
1151749282 17:76027470-76027492 CAGGCTCGGCCCCGCCCTCAGGG - Intergenic
1151978339 17:77494887-77494909 CCAGCTGGGCAGCTCCCGCAGGG - Intronic
1152722379 17:81929278-81929300 CGGGCTGGGGAGGACACTCAGGG + Intergenic
1154325715 18:13389260-13389282 AGGGATGGGCAGCTCCCTCATGG + Intronic
1154325728 18:13389302-13389324 AGGGATGGGCAGCTCCCTCGTGG + Intronic
1154325741 18:13389344-13389366 AGGGGTGGGCAGCTCCCTCGTGG + Intronic
1155054187 18:22170511-22170533 CGGGCTGGTCAGCGCAGTCCGGG + Intronic
1160433840 18:78831149-78831171 GGGGCTGTGCAGAGCCCTTAGGG - Intergenic
1160745521 19:709315-709337 CGGGCTGGGCCGCGCCTGCCGGG + Intronic
1161283068 19:3456213-3456235 CAGGGTGGGCAGCGCCCGCCCGG - Intronic
1161319161 19:3633093-3633115 CGGGGTGGGCAGCGCCTTCGGGG + Exonic
1161395589 19:4043536-4043558 GGGGCGGGGCGGCGCCCTCAGGG - Intergenic
1162808220 19:13150033-13150055 CGGGCTGGGCAAGGCCGTCGGGG - Intronic
1163002357 19:14376124-14376146 GGGGCCGGGCAGCCCCCACACGG - Intergenic
1163687120 19:18717945-18717967 GGGCCTGGGCAGCCCCGTCACGG + Intronic
1163690339 19:18735237-18735259 AGGGCTGGGCAGAGGCCTGAGGG + Intronic
1163786056 19:19275498-19275520 GGGGCTGGGCAGCACCCACTGGG + Intergenic
1163826093 19:19525768-19525790 GTGGCTGGGCAGCCCCCACAGGG + Intronic
1164127494 19:22331761-22331783 CTGCCTGGGCACAGCCCTCAGGG - Intergenic
1165789578 19:38483483-38483505 GGGGATGTGCAGCGCCATCATGG - Exonic
1166388837 19:42397609-42397631 AGGCCTGGGCCGTGCCCTCAAGG + Intergenic
1166731415 19:45061059-45061081 AGGGCTGGGCAGTCCCCACAGGG + Intronic
1167114544 19:47480921-47480943 CGTGCTGGGCAGAGCCCTGTGGG - Intronic
1167287016 19:48603947-48603969 GGGGCCGGGCTGGGCCCTCAGGG - Intronic
1167424359 19:49422451-49422473 GGGGACGGGCAGCGCGCTCAGGG + Exonic
924988211 2:289265-289287 CGGGCGGGGCAGACCCCTCGAGG - Intergenic
925153625 2:1634433-1634455 CGGGCAAGGCAGGGGCCTCAGGG - Intronic
925393895 2:3518858-3518880 CGGGATTGGCAGCGACCTGAAGG - Intronic
925753670 2:7111966-7111988 CAGGCTGGGCAGCAGCCTCAAGG - Intergenic
927860485 2:26557382-26557404 AGGGCTGGGCAGCAACCACATGG + Intronic
931021359 2:58047505-58047527 GGGGCAAGGCAGCGGCCTCAGGG - Intronic
932475648 2:72004099-72004121 TGGGCTGGGCTGCAGCCTCATGG - Intergenic
933206375 2:79512783-79512805 CGGCCTGGGGAGCGCCCGAAAGG - Intronic
935872850 2:107469682-107469704 CGGGCTGCGCATAGCGCTCAGGG - Intergenic
936077597 2:109411624-109411646 TGGGCTGGGCTCTGCCCTCAGGG - Intronic
937895931 2:126976807-126976829 CGGGCAGGGCAGGGCCAGCAGGG - Intergenic
940531832 2:154887172-154887194 CGGCCTGTGCAGAGCCCTTATGG - Intergenic
940826236 2:158415939-158415961 CTGAATGGGCAGAGCCCTCATGG - Intronic
947565620 2:231191028-231191050 CAGGCGGGGCAGCCCCCCCAGGG - Intergenic
948355120 2:237371817-237371839 CAGGCTGGGCAGCTCCCGGAAGG + Exonic
949017106 2:241719699-241719721 GAAGCTGGGCAGAGCCCTCAGGG - Intronic
1168827482 20:823388-823410 GGGGCTGGGCAGTGCCCACGGGG + Intergenic
1170643865 20:18179373-18179395 CTGTCAGGGCAGGGCCCTCATGG - Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172885487 20:38228155-38228177 CGGTCTGGTCAGCGCCCTGCAGG - Exonic
1175256851 20:57652849-57652871 AGAGCTGGGCTGCTCCCTCAGGG + Intronic
1176621806 21:9066202-9066224 AGGGCTGGGCAGCGCCACCTGGG + Intergenic
1177722678 21:24928199-24928221 CTGCATGGGCAGAGCCCTCATGG + Intergenic
1178261862 21:31107070-31107092 CGGCAGGGGCAGGGCCCTCATGG - Intergenic
1178437130 21:32569787-32569809 CAGGGGGGGCTGCGCCCTCAGGG - Intergenic
1179143988 21:38751727-38751749 CGGGCTGGGGAGAGCACTCCAGG + Intergenic
1179190534 21:39118690-39118712 CAGGCTGGGCAGGGACCTCAGGG + Intergenic
1180170442 21:46055508-46055530 CTAGGTGGGCAGAGCCCTCAGGG - Intergenic
1180877706 22:19182524-19182546 GGGGCTGGGCAGCCCCCTGGAGG + Intronic
1181322942 22:22022675-22022697 GGGGCTGGGCAGTCCCCTGATGG + Intergenic
1181637112 22:24179681-24179703 AGGGCTGGGCACCGCCCTTTTGG + Intergenic
1183691039 22:39388613-39388635 CTCGCTGAGCAGCGGCCTCAGGG - Intergenic
1184089221 22:42283662-42283684 AGGGCTGGGCAGGGGCCTCCCGG - Intronic
1184673388 22:46027479-46027501 CGGGCGGCGCAGCGCCCTCGGGG + Intergenic
1184837835 22:47034538-47034560 TGGGCTTGGCAGTGACCTCAGGG - Intronic
950191181 3:10977270-10977292 GGGGCTGGGCAGAGCCCCCTGGG + Intergenic
952356967 3:32593297-32593319 GTGGCCGGGCAGCGCACTCAGGG - Intergenic
952745504 3:36773480-36773502 CGGCCTGTGCAGCGCCGTGATGG - Intergenic
954426152 3:50444132-50444154 GGGGCTGGGCAGGTCCCCCAAGG + Intronic
954467203 3:50662692-50662714 CTGGCTGACCAGAGCCCTCAGGG + Intergenic
954594518 3:51813700-51813722 TGTGCTTGGCAGGGCCCTCAGGG + Intergenic
955228945 3:57082232-57082254 GGGGCTGGGTAGCACCTTCAGGG + Intergenic
958469406 3:94498716-94498738 CGGCAGGGGCAGAGCCCTCATGG + Intergenic
963581838 3:147135298-147135320 CTGCCGGGGCAGAGCCCTCATGG - Intergenic
970422512 4:15918749-15918771 GAGGCTGGTCAGTGCCCTCAAGG - Intergenic
971119651 4:23689571-23689593 CTGCATGGGCAGAGCCCTCATGG + Intergenic
979735012 4:124072746-124072768 CTGGCTGGGTAGCACACTCATGG - Intergenic
980027194 4:127781699-127781721 CGGGCTCGGCAGCTCCCCCGGGG + Intergenic
981606560 4:146546573-146546595 GGGGCTGAGCAGCCACCTCATGG - Intergenic
982504922 4:156205483-156205505 CTGCATGGGCAGAGCCCTCATGG - Intergenic
985231318 4:187821134-187821156 TGTGCTGGGCATTGCCCTCATGG - Intergenic
985579825 5:690717-690739 CGGGCTGGGCAGGGCCCGGAGGG - Intronic
985594671 5:782776-782798 CGGGCTGGGCAGGGCCCGGAGGG - Intergenic
985850713 5:2387221-2387243 TGAGCTGGGCAGGGCCTTCATGG + Intergenic
985880125 5:2633045-2633067 TGTGCTGGGCAGAGCCCTGATGG - Intergenic
986394367 5:7314031-7314053 AGGTCTGGACAGGGCCCTCAGGG + Intergenic
988264124 5:28928099-28928121 CCGGATGGGCGGCGCACTCAGGG - Intergenic
992962788 5:81972269-81972291 CGGGCTGGGCTGCGGGGTCAGGG + Exonic
998218108 5:140252840-140252862 GGGGCAGGGCAGAGCCCTGAGGG + Intronic
998879705 5:146633651-146633673 AGGGCTGGGCAGAGGCCTGAAGG + Intronic
999367978 5:151035211-151035233 TGGGCTGTGCTCCGCCCTCAGGG - Intronic
1002618941 5:180472842-180472864 CCGGCTGGGCAGTTCTCTCAGGG - Intergenic
1006512444 6:34528965-34528987 TGGGCTGGGCACTGCCCTCTGGG + Intronic
1007782565 6:44262958-44262980 CTGGCTCGGCAGAGCCCTGAGGG - Intronic
1016658153 6:146544045-146544067 CGGGGTGGACTTCGCCCTCAAGG + Exonic
1016682330 6:146845192-146845214 CTGCCGGGGCAGAGCCCTCAAGG - Intergenic
1017206508 6:151808498-151808520 CGGGCTGGGCCGCGCGCCCCGGG - Intronic
1017946585 6:159100968-159100990 ACAGCTGGGCAGGGCCCTCAAGG - Intergenic
1019461688 7:1162449-1162471 GGGCCTGGGCAGAGCCTTCAAGG - Intergenic
1019588635 7:1817855-1817877 TGGGCTGGGCCCCGCCCTGATGG + Intronic
1019754592 7:2759793-2759815 AGGGCTGGGCCGCTCCCTCCAGG + Intronic
1023837445 7:44076650-44076672 CCGGTTGGGCAGAGCTCTCATGG + Intronic
1024020195 7:45361640-45361662 CAGGCTGGGCACTGCCCTCATGG - Intergenic
1024098713 7:46007061-46007083 CAGGCTGGGCTGTGCCTTCAGGG + Intergenic
1025995358 7:66524183-66524205 AGGGCTGGCCAGAGCCTTCAGGG + Intergenic
1029274830 7:99397836-99397858 AGGGCTGGGCTGCGCACGCAGGG - Intronic
1032947759 7:136871271-136871293 CGGGCTGTGCGGAGCCCTGAGGG + Intronic
1033037081 7:137885029-137885051 CTGGCTGGGCAGAGCCATCTTGG + Exonic
1033159431 7:138982500-138982522 AAGGCTGGGCAGCCCCTTCAAGG - Intergenic
1034451200 7:151138205-151138227 TGGGCTGGCCCGCGCCCTGAGGG + Exonic
1035580861 8:738313-738335 CGGGCTGGGCTGCGCGCACGGGG + Intergenic
1036032700 8:4991649-4991671 GGGGCTCGGCAGCGCGCTCCAGG - Intronic
1037048840 8:14343182-14343204 CTGCATGGGCAGGGCCCTCATGG + Intronic
1037882622 8:22580330-22580352 CAGCCTGGGCAGCCCCCTCCTGG + Intronic
1038798159 8:30727589-30727611 CGGGCTGGCCAGCGCGCGCAGGG - Exonic
1040569138 8:48592551-48592573 TGGGATGGGCTGCCCCCTCAGGG + Intergenic
1048043316 8:130751084-130751106 CTGCCGGGGCAGAGCCCTCATGG - Intergenic
1048275124 8:133060104-133060126 CGGGTTGGGCAGGGGCCTCTCGG + Exonic
1048839373 8:138551523-138551545 CTGGAAGGGCAGAGCCCTCATGG + Intergenic
1049409395 8:142465705-142465727 CGGGCAGGGCTGGCCCCTCATGG + Intronic
1049566390 8:143341315-143341337 CCGGCTGGGCACCGCCTGCAGGG + Intronic
1049567536 8:143348844-143348866 CGGGCTGGGCTCCTGCCTCAGGG - Intronic
1049715064 8:144085896-144085918 CGGGCTGGTCAGCACCAGCAGGG - Exonic
1049799843 8:144512658-144512680 GGAGCTGGGCAGGGCCCCCAGGG + Exonic
1050915210 9:11122585-11122607 CTGCATGGGCAGAGCCCTCATGG - Intergenic
1051418856 9:16870965-16870987 CGAGCAGGGCAGCCCCCTCCCGG - Intergenic
1052855940 9:33406659-33406681 AGGGCAGGGCAGGTCCCTCAAGG + Intergenic
1056595169 9:88002070-88002092 CTGCAGGGGCAGCGCCCTCATGG + Intergenic
1056595825 9:88007017-88007039 CTGGCTGGACTGCGGCCTCAGGG - Intergenic
1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG + Intergenic
1057507207 9:95644836-95644858 CTGGCTGGGCAGCCACTTCACGG + Intergenic
1060883215 9:127133222-127133244 CGGGCAGGGCAGCCTCCCCAGGG - Intronic
1061050396 9:128191592-128191614 CGGCCGGGGCAGCGCCCTCTGGG + Intronic
1061720177 9:132546568-132546590 CTGGCAGGGCAGCCCCCTCGTGG - Intronic
1062280825 9:135750916-135750938 CGGGGAGGGCAGCGGCCTCAGGG - Intronic
1187219769 X:17312660-17312682 CATTCTGGGCAGCACCCTCAAGG - Intergenic
1189087992 X:38047250-38047272 CTGGAGGGGCAGGGCCCTCATGG - Intronic
1192047005 X:67686404-67686426 CTGACTGGGCAGGGCCCCCAGGG + Intronic
1193370735 X:80694314-80694336 CTGCCGGGGCAGAGCCCTCATGG + Intronic
1201158324 Y:11151655-11151677 AGGGCTGGGCAGCGCCACCTGGG + Intergenic