ID: 904615386

View in Genome Browser
Species Human (GRCh38)
Location 1:31746717-31746739
Sequence GAGAAGGGCTGCAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 1, 2: 4, 3: 70, 4: 610}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904615386_904615396 4 Left 904615386 1:31746717-31746739 CCAACTTCCCTGCAGCCCTTCTC 0: 1
1: 1
2: 4
3: 70
4: 610
Right 904615396 1:31746744-31746766 CAAAGGCCAGCCCCGTGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
904615386_904615397 5 Left 904615386 1:31746717-31746739 CCAACTTCCCTGCAGCCCTTCTC 0: 1
1: 1
2: 4
3: 70
4: 610
Right 904615397 1:31746745-31746767 AAAGGCCAGCCCCGTGGCCTGGG 0: 1
1: 0
2: 0
3: 22
4: 200
904615386_904615393 -1 Left 904615386 1:31746717-31746739 CCAACTTCCCTGCAGCCCTTCTC 0: 1
1: 1
2: 4
3: 70
4: 610
Right 904615393 1:31746739-31746761 CCCCACAAAGGCCAGCCCCGTGG 0: 1
1: 0
2: 3
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904615386 Original CRISPR GAGAAGGGCTGCAGGGAAGT TGG (reversed) Intronic
900725534 1:4214141-4214163 GGGAAGGGAGGGAGGGAAGTAGG - Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900774475 1:4571899-4571921 GAGAAGGGCAGGAGGGAGGAAGG + Intergenic
901300772 1:8198688-8198710 GAGAAGGGGAGGAGGAAAGTGGG - Intergenic
901388124 1:8924553-8924575 GAGAAGGGCTGCAAAGGAGAAGG - Intergenic
901637748 1:10678192-10678214 GAGACGGGCTGCAGGGAGGGCGG - Intronic
902183258 1:14705766-14705788 GAGAAGGGGAGTAGGGAAGGAGG + Intronic
902481444 1:16714151-16714173 GAAAAGGGCAGCAGGGAACAAGG + Intergenic
902632940 1:17716464-17716486 GTGAAGGGAGGCAGGGAAGAAGG + Intergenic
902995792 1:20223731-20223753 GGGAAGGGAGGCAGGGAAGCGGG - Intergenic
903360659 1:22775029-22775051 GAGGAGGGCAGCAGGGGAGTGGG - Intronic
903450647 1:23451734-23451756 GAGAAGGTCTGCTGGGAGGAGGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903891483 1:26573174-26573196 GGGGAGGGCTGCAGGGGAGCAGG - Intronic
903942564 1:26941821-26941843 GAGATGGACTGCAGGGACTTGGG + Intronic
904046539 1:27612648-27612670 GAGAAAGGCTACAGGCATGTAGG + Exonic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904856737 1:33503512-33503534 TGAAAGGGCTGCAGGGAGGTGGG - Intergenic
904918085 1:33984809-33984831 GAGAAGGGAGGGAGGGAAGGAGG + Intronic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
905245113 1:36607421-36607443 GAGAAGGCCTGCAAGAAAGTGGG - Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906078976 1:43071253-43071275 CAGCAGGGCTGCAGGAAGGTGGG + Intergenic
906222058 1:44088532-44088554 AGAAAGGGCTGCAGGGCAGTGGG - Intergenic
906633243 1:47389983-47390005 GAGAAGTGGGGCAGGGAATTGGG + Intergenic
906732112 1:48091804-48091826 CCCAAGGGCTGAAGGGAAGTTGG - Intergenic
906851178 1:49251641-49251663 GTGAATGCCTGCAGGGAAGCAGG + Intronic
908647116 1:66290190-66290212 TAGAAGGGGTGAAGGGCAGTGGG + Intronic
910063117 1:83117994-83118016 GTGAAGAGCTGCTGGCAAGTGGG - Intergenic
911922904 1:103789832-103789854 GAGAAAGGCAACATGGAAGTAGG - Intergenic
912387339 1:109278146-109278168 GAGAAAAGCAGCAGGTAAGTGGG - Intergenic
912705259 1:111906879-111906901 GAGAAAGGCTTCAGAGATGTTGG - Intronic
913400246 1:118423638-118423660 GGGCAGGGCTGCAGGGCAGCTGG + Intergenic
913670737 1:121095316-121095338 GAGGAGGGAGGCAGGGAAGCAGG - Intronic
913720984 1:121594326-121594348 GAGGGGGGGGGCAGGGAAGTGGG + Intergenic
914022500 1:143882739-143882761 GAGGAGGGAGGCAGGGAAGCAGG - Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914660986 1:149790681-149790703 GAGGAGGGAGGCAGGGAAGCAGG - Intronic
915471079 1:156126226-156126248 GAGCAGGGCTGCTGAGGAGTGGG + Intronic
916052978 1:161049048-161049070 GAGCAGGCATGCTGGGAAGTTGG - Exonic
916104071 1:161418025-161418047 GAGAAGGGAGGGAGGGAGGTAGG + Intergenic
916275309 1:162987643-162987665 GAGGGGTGCTGCAGGGAAGTCGG - Intergenic
917310078 1:173669703-173669725 GGGCAGGGCTGGAGGGGAGTGGG - Intronic
918487675 1:185046016-185046038 GAGTAGGGCTGCAGAGAGGCTGG - Intronic
918521557 1:185420542-185420564 GAAAAGGACTGCAGGGAAGCCGG + Intergenic
919762395 1:201106304-201106326 GAGATGGGAAGCAGGGAAGGGGG - Intronic
920031220 1:203038549-203038571 GAGAAGGGCATCAGGGGAGGGGG - Intronic
920111289 1:203589026-203589048 GACAAGGATGGCAGGGAAGTGGG + Intergenic
920202393 1:204267601-204267623 GAGATGGGATGCAGGGAAAAGGG + Intronic
920233229 1:204484100-204484122 GAGAAGGAAGGCAGAGAAGTGGG + Intronic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
920556200 1:206906792-206906814 GAAAAGGGCTGCTGGAAAGACGG + Intronic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
920825834 1:209423648-209423670 CAGAAGGCTTGCAGGCAAGTTGG + Intergenic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
921272954 1:213489219-213489241 AAGGAGGGCTGCTGGGAAGAAGG + Intergenic
922517865 1:226222191-226222213 GAGAAGGGGTGGAAGGAAGATGG + Intergenic
922543655 1:226437709-226437731 GAGGAGGGCTGAAGGGAAACTGG - Intergenic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
923108145 1:230869430-230869452 GAGAGGGGCTTGGGGGAAGTGGG - Intronic
923275028 1:232388153-232388175 GAGAGGGGCTGCAGAGAGGAAGG - Intergenic
923564329 1:235065335-235065357 GAGGAGGGAATCAGGGAAGTAGG + Intergenic
923862794 1:237908423-237908445 GAGAAGGATGCCAGGGAAGTTGG + Intergenic
924037678 1:239953696-239953718 GAGGAGGGCTACAGGCAAGAGGG - Intergenic
924048322 1:240054908-240054930 GGGAGGGGGTGCAGGGAAGGAGG + Intronic
1062841754 10:678573-678595 GAGCATGGCTGCAGGGAGGACGG - Intronic
1062916091 10:1242097-1242119 GGGACGGGCTCCAGGGAAGGCGG - Intronic
1063426342 10:5953005-5953027 GAGAAGAGGTGCAAGGAAGCGGG - Exonic
1063440878 10:6071958-6071980 GTGAAGGGCTGAGGGGACGTGGG + Intergenic
1064218148 10:13417643-13417665 GATAAGGGAGGCAGGGAAGCAGG + Intergenic
1064942426 10:20749719-20749741 GAGAAAGTATCCAGGGAAGTGGG - Intergenic
1065225450 10:23538920-23538942 GAGAAGGTCTGCAGAGGAGATGG - Intergenic
1065369902 10:24973192-24973214 GAGTAGTGCTGCTGGCAAGTCGG - Intergenic
1065491234 10:26283759-26283781 GAAAAGGGCTGAAGGGAGGATGG + Intronic
1067246499 10:44551288-44551310 GAGAAGGTCAAAAGGGAAGTGGG + Intergenic
1067317354 10:45180833-45180855 GACAAGGCCTGCAGGGCAGAGGG + Intergenic
1067601837 10:47612126-47612148 GAGAAGGGCTGGATTGGAGTGGG + Intergenic
1068217879 10:54006964-54006986 TAGAATGGCTGCATGGGAGTAGG - Intronic
1068381066 10:56254732-56254754 TAGGAGGGATGCAGGGAAATAGG - Intergenic
1068572736 10:58649034-58649056 GAGAAGGTGTTCAGGGTAGTAGG - Intronic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069753608 10:70760503-70760525 GAGAAGGGGGGCAGTGAGGTTGG - Exonic
1069771505 10:70903459-70903481 CAGAAGTGTTGCAGGGAAGGCGG - Intergenic
1069821413 10:71230798-71230820 GGGCAGGGAAGCAGGGAAGTGGG + Intronic
1070343973 10:75523794-75523816 AAGAAAGGATGCAGGGAAGAAGG - Intronic
1070731260 10:78830135-78830157 GGGAATGGCTGGAGGGGAGTGGG - Intergenic
1070888625 10:79925855-79925877 GAGAAGGGAAGGAGAGAAGTCGG - Intergenic
1071463522 10:85920153-85920175 AAGAAAGACAGCAGGGAAGTGGG - Intronic
1071970102 10:90896363-90896385 GAGAAGCGCTGCTCGGCAGTTGG - Exonic
1073019859 10:100434092-100434114 GGGGAGGGCGCCAGGGAAGTAGG + Intergenic
1073797045 10:107000016-107000038 GAGGAGGGAAGCAGAGAAGTGGG + Intronic
1073881394 10:107984853-107984875 GAAAAGGGCTGTAGGCAAGCAGG + Intergenic
1074110750 10:110421175-110421197 GCCATGGGCTGCAAGGAAGTAGG + Intergenic
1076088231 10:127654758-127654780 AAGAAGAGCTTCTGGGAAGTTGG - Intergenic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076620238 10:131782604-131782626 GAGAAGTGTTGTAGGAAAGTTGG - Intergenic
1076802279 10:132836117-132836139 GAGCAGGGCTGCAGGGGAGGGGG - Intronic
1076818869 10:132928235-132928257 AGGAAGGGCTGCTGGGAAGGAGG + Intronic
1077272217 11:1686720-1686742 GAGGAGGGAGGCAGGGAAGGAGG - Intergenic
1077307168 11:1873597-1873619 GAGAAGGGAGGAAGGGAAGGAGG + Intronic
1077367639 11:2167527-2167549 GAGAAGGGCAGGAGGGAGGGAGG + Intronic
1077388867 11:2290076-2290098 GGGAAGGGCTGCAGGGATCCAGG + Intergenic
1077432659 11:2523629-2523651 TAGAAGGGCAGCTGTGAAGTGGG + Intronic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1077609219 11:3634165-3634187 CCAAAGGGCTGCATGGAAGTGGG + Intergenic
1078277850 11:9867857-9867879 GGGAAGGGCTACTGGGAAGGGGG + Intronic
1078339446 11:10488569-10488591 GAGTAAGGCTGCAGAGATGTGGG + Intronic
1080961336 11:37164009-37164031 GAGAAGGGATGCAGAGAATGAGG - Intergenic
1081582085 11:44359447-44359469 GAGAAGGGGAGCAGAGGAGTAGG + Intergenic
1081991377 11:47339409-47339431 GAACAGGGCAGGAGGGAAGTAGG + Intronic
1082122259 11:48391883-48391905 GAAAATGGGTGCAGGGCAGTGGG - Intergenic
1082834047 11:57639340-57639362 GAGAGAGGCAGCTGGGAAGTGGG - Intergenic
1083147812 11:60772035-60772057 GAGAAGTGCTGAAAGGAAGCAGG + Intronic
1083172976 11:60933942-60933964 GAGAAGTGAGGCAGGGAAGGAGG - Intronic
1083346733 11:61998724-61998746 TAAAAGTGCTGGAGGGAAGTGGG - Intergenic
1083571148 11:63762961-63762983 GTGCAAGGCTGCAGGGAACTGGG + Exonic
1083794400 11:65006573-65006595 GAGCAGGGGAGCAGGGAAGCCGG + Intergenic
1083826996 11:65209655-65209677 GAGCTGGGCTGCAGTGGAGTGGG - Intronic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1084088301 11:66864816-66864838 GAGAAGGGCTCCCCGGAGGTGGG + Intronic
1084538567 11:69773478-69773500 AAGAAGGGCTGCAGCAAAGCAGG + Exonic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085021646 11:73213745-73213767 GAGAAGCGCAGGAGGGAGGTGGG - Intergenic
1085390410 11:76179255-76179277 GAGAAGGGCTGCAGGGCTGCAGG + Intergenic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1085553415 11:77396806-77396828 TTGGAGGGCTGCAGGGAAGCTGG - Intronic
1086184417 11:83996822-83996844 GAGAAGGGTAGCAGGGAGCTTGG + Intronic
1086875083 11:92086080-92086102 GAGAAGGGCTGAGGTGGAGTTGG + Intergenic
1087194988 11:95296394-95296416 GGGAAGGGGGGCAGGGATGTTGG - Intergenic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1088510254 11:110566324-110566346 GAGAAGGGTTGCAGGGAAGTGGG + Intergenic
1088787027 11:113191232-113191254 GAGCAGGGTTGGAGGGAATTCGG + Intronic
1089297826 11:117480602-117480624 GAGGAGGGCAGCAGGGAGCTTGG + Intronic
1089433084 11:118438001-118438023 GAGAAGGGCGGGAGGGAGCTCGG - Intronic
1089747862 11:120629655-120629677 GAAAAGAGCAGGAGGGAAGTTGG - Intronic
1089774964 11:120829668-120829690 GAGAAAGGCTGCCGGGAAGTGGG - Intronic
1090184411 11:124727071-124727093 GAGAGGGCATACAGGGAAGTGGG + Intergenic
1090267371 11:125361787-125361809 GAGGAAGTCTGAAGGGAAGTTGG + Intronic
1090343265 11:126044740-126044762 CAGAAGGGCAGCAGGGAGGTGGG + Intronic
1090768226 11:129895514-129895536 GAGAAGGGCTGCGGGTTAGGGGG - Intronic
1090875602 11:130786219-130786241 GAGAAGGTTTGAAGGGCAGTGGG - Intergenic
1090935263 11:131335859-131335881 GTTAAGGGCTTCAGGGATGTTGG + Intergenic
1090963517 11:131578456-131578478 GGGGAGAGCTGCAGGGAAGTGGG + Intronic
1091712602 12:2752650-2752672 AAGAAGGGCTGCAGGAGAGTCGG + Intergenic
1091751327 12:3022864-3022886 GAGGAGAGCTGAAGGGGAGTGGG - Intronic
1091784597 12:3235531-3235553 GACAAGGACTCAAGGGAAGTGGG - Intronic
1092161425 12:6317418-6317440 GAGAAGGGGTGCTGGGGAGGGGG + Intronic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1093494830 12:19744393-19744415 GGGAAGGGATGCAGGGAGCTTGG - Intergenic
1094199191 12:27779994-27780016 GAGAAGGGCGGCGGGGGAGGAGG + Intergenic
1094208809 12:27869017-27869039 GAGAAGGGCTGCATACAATTTGG - Intergenic
1095207674 12:39457047-39457069 GAGAAGGGAGGAAGGGAAGGAGG + Intergenic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1096848626 12:54421239-54421261 GGGGAGGGGTGCAGGGAAGGAGG + Intergenic
1097201511 12:57282798-57282820 GAGAAGGGCAGCAGAGACCTAGG + Intronic
1097608436 12:61785106-61785128 GGGAAGGGCAGGAGGGAAGGAGG - Intronic
1100138567 12:91586678-91586700 GACAATGGGTGAAGGGAAGTGGG - Intergenic
1100452713 12:94722783-94722805 GAGAAGGGCTGGTAGGAACTAGG - Intergenic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1100893950 12:99158761-99158783 GAGATGAGTTGCAGGGAAGGAGG - Intronic
1101923552 12:108952669-108952691 GAGATGGGCTGCAGGGCACAGGG - Intronic
1102006872 12:109594847-109594869 GAGAAATGCTGCAGGGCAGAAGG + Intronic
1102886742 12:116527802-116527824 GTAAAGGTCTGAAGGGAAGTCGG - Intergenic
1102990700 12:117313794-117313816 GAGAAAGGCTGTTGGGAAGTAGG - Intronic
1104558344 12:129822203-129822225 GAGCAGGGCTGGAGGGGAGAAGG + Intronic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1105037104 12:132933529-132933551 GAGAAGGGCTGCAGCGAGGAAGG - Intronic
1105614197 13:21997687-21997709 GAGAAGGACAGTGGGGAAGTGGG - Intergenic
1105967021 13:25394287-25394309 TAGCAGTGATGCAGGGAAGTTGG + Intronic
1105997636 13:25687496-25687518 GGGAAGGCCTGCTGGGATGTGGG - Intronic
1107336551 13:39361917-39361939 GAAAAGGGCAGGAGGGAGGTAGG + Intronic
1111329033 13:86738213-86738235 GGGAAAAGATGCAGGGAAGTAGG + Intergenic
1112846147 13:103646646-103646668 GAGAAGTTGTGCTGGGAAGTAGG + Intergenic
1113881046 13:113626514-113626536 GAGGGGGGCTGCGGGGAAGCGGG - Intronic
1115497820 14:34024529-34024551 GAGAAGGGCTGGAAGGAAAGGGG - Intronic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1116385849 14:44328858-44328880 GGGAAGGGTTGCAGGGGACTTGG - Intergenic
1117338676 14:54775816-54775838 GAAAAGGGCTTCAGGCAAGACGG + Intronic
1117910821 14:60637344-60637366 GAGAAGGGGAGCTGAGAAGTTGG - Intergenic
1119151292 14:72361949-72361971 TAAGAGGGCTGCAGGGAAGCAGG + Intronic
1119679577 14:76582094-76582116 GAGAAGGGGGACAGGGAGGTGGG + Intergenic
1119847420 14:77840853-77840875 AAGAAGGGCAGCAGGGAGGGAGG + Intronic
1120750639 14:88194618-88194640 GAGATGGGCAGGAGGGAAGATGG + Intronic
1121026992 14:90623648-90623670 GAGTAGGGCTGCAGGTGAGCAGG + Intronic
1121453531 14:94024319-94024341 GAGAAGGGGTGCAGGAAGGTTGG + Intergenic
1122508595 14:102248207-102248229 GAGAAGGGTTGCAGAGCATTAGG - Intronic
1122971424 14:105153777-105153799 GAGGAAGGCAGCAGAGAAGTTGG - Intronic
1122972054 14:105156339-105156361 GAGCAGGGCTGCAGGTGGGTGGG - Intronic
1123004892 14:105316406-105316428 GAGAAGGGCTGTGGGGCTGTGGG - Intronic
1123109758 14:105860577-105860599 GGGCAGGACTGCAGGGAACTGGG - Intergenic
1124139364 15:27063883-27063905 GAGAAGGGGTGTGGGGAAGTGGG - Intronic
1124450975 15:29790679-29790701 GGGAAGGGTGGTAGGGAAGTAGG - Intronic
1124578138 15:30927425-30927447 GAGACGGGCTGCAGGGATGAGGG + Intronic
1124604919 15:31162727-31162749 GAGAGGGGATGCAGGGATGAGGG + Intergenic
1124614699 15:31233142-31233164 AAGAAGGCCTCCAGGGAAGGCGG + Intergenic
1125121232 15:36161143-36161165 GAGAAAGACTGAAGGGAAGAAGG + Intergenic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125529561 15:40403784-40403806 AGGAATGGGTGCAGGGAAGTTGG + Intergenic
1125756643 15:42069714-42069736 CAGAGGGCCTGCAGGGATGTGGG + Intronic
1126712361 15:51473125-51473147 GAGGAGAGCTGTAAGGAAGTTGG - Intronic
1127711102 15:61598946-61598968 GAGAAGGGGTGGGGGGAAGACGG + Intergenic
1127797687 15:62452600-62452622 GCCAAGGGCTGGAGGGAAGGAGG - Intronic
1127885432 15:63195499-63195521 GAGAAAAGCTGGAGGGAAATAGG + Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128632168 15:69278642-69278664 GAGAAGGGGTGGAGAGAGGTGGG + Intergenic
1128914010 15:71543413-71543435 GAGCAGGGCAGCAGGAATGTGGG + Intronic
1129061214 15:72861738-72861760 GACAGGGGCTGCAGGGCAGCAGG - Intergenic
1129239039 15:74240958-74240980 GAGCAAGGCTGCTGGGGAGTGGG + Intronic
1130079730 15:80722059-80722081 TAACAGGGCTGCAGGGAAGATGG - Intronic
1130143711 15:81255427-81255449 GAGACTGGCTGCATGGCAGTGGG + Intronic
1130770119 15:86915853-86915875 GAGCAGAGCTGCAGGAAAGCAGG + Intronic
1131073965 15:89483435-89483457 GAGATGGGCTGCATGGGAGGTGG - Intronic
1131634547 15:94217315-94217337 GGGAAGGGTAGCAGGGGAGTGGG + Intergenic
1133202594 16:4213248-4213270 GAGAAAGACTGCAGGGAGATTGG + Intronic
1133908774 16:10045761-10045783 GAAAAGGGTGGCATGGAAGTTGG - Intronic
1133915608 16:10106833-10106855 GAGAAGGAAGGCAGGGAAGCTGG + Intronic
1135308618 16:21388200-21388222 GAGAAGGACAGCCAGGAAGTGGG + Intergenic
1135468921 16:22712103-22712125 GAGGAAGGCTGCAGGGTAGGTGG + Intergenic
1135967914 16:27051308-27051330 GAGCAGTGCAGCTGGGAAGTTGG - Intergenic
1135983753 16:27168588-27168610 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1136039041 16:27563529-27563551 AAGAAAGACTGCAGGGAAGAGGG + Intronic
1136039045 16:27563544-27563566 GAAGAGGGCTGCAGGGAAGAGGG + Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136148197 16:28328509-28328531 GAGAAGGACAGCCAGGAAGTGGG + Intergenic
1136228191 16:28872713-28872735 GAGCAGGTCTGCAGGGGAGGAGG + Intronic
1136305360 16:29367331-29367353 GAGAAGGACAGCCAGGAAGTGGG + Intergenic
1136346491 16:29679353-29679375 GAGCAAGGCTGCAGGGACATGGG - Intronic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1137484934 16:48882833-48882855 AAGAAGGGGTGCAGAGAAGAAGG - Intergenic
1137598200 16:49738641-49738663 GAGAAAGGGTGCAGGGGAGAAGG + Intronic
1138722291 16:59096548-59096570 GACAGGGGGTGCAGGGCAGTGGG + Intergenic
1139276040 16:65728451-65728473 GAGAATGGCAGCTGGGAACTAGG + Intergenic
1139475957 16:67202675-67202697 CGGAAGAGCTCCAGGGAAGTGGG - Exonic
1140448945 16:75054491-75054513 CATAGGGTCTGCAGGGAAGTGGG + Intronic
1141024924 16:80537476-80537498 GGGAAGGAATGCAGGGAAGGAGG + Intergenic
1141255700 16:82400544-82400566 GACAAGGGCTTAAGGGAAGAAGG + Intergenic
1141360718 16:83392925-83392947 GTGAAGAGCTGGAAGGAAGTTGG + Intronic
1141722154 16:85762415-85762437 GGAAGGGGCTGCAGGGAAGGAGG + Intergenic
1141944890 16:87303215-87303237 GGGAAGGGGTGCAGGGATGAGGG + Intronic
1142024108 16:87803309-87803331 GAGAAGGGAAGAAGGGATGTAGG - Intergenic
1142372057 16:89688023-89688045 GAGAAGGGAAGCCGGGAAATGGG + Intronic
1142378196 16:89717557-89717579 GTGAAGGGCAGCAGGGAGGTGGG - Intronic
1142508374 17:380314-380336 GAGAAGGGCTTCCGGGAGGCTGG - Intronic
1143124372 17:4632148-4632170 GAGATGGGCAGCTGGGAATTTGG - Intronic
1143164991 17:4893165-4893187 GAGAAGGGCTGTGGGGATGGAGG + Intronic
1144626270 17:16845845-16845867 GAGAAGGGCTGGAAAGAAGAGGG + Intergenic
1144880163 17:18426875-18426897 GAGAAGGGCTGGAAAGAAGAGGG - Intergenic
1145152071 17:20517509-20517531 GAGAAGGGCTGGAAAGAAGAGGG + Intergenic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145911408 17:28545522-28545544 GAGCAGGGCTTCTGAGAAGTGGG - Intronic
1146496220 17:33324840-33324862 GAGAAGGGCAGCAGGCAGGCTGG - Intronic
1146683523 17:34825127-34825149 GAGCATGGCTGAAGTGAAGTTGG - Intergenic
1147237736 17:39070039-39070061 GACAGGGGCTGCAGGGGAGCAGG + Intronic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1147357958 17:39912294-39912316 GAGTTGGGCAGCAGGGAAGGAGG - Intronic
1147580417 17:41624539-41624561 GAGAAGGGCTGGAGAGGAGAGGG + Exonic
1148284730 17:46377892-46377914 GAGAAAGGCTGAAGAGAAGTGGG - Intergenic
1148306952 17:46595814-46595836 GAGAAAGGCTGAAGAGAAGTGGG - Intronic
1148441071 17:47711855-47711877 GGGGAGGGGTGCAGGGAGGTGGG - Exonic
1148652748 17:49261282-49261304 GAGAAGGGCCCAAGAGAAGTGGG - Intergenic
1149963279 17:61136044-61136066 GCGAAGGGGTGCAGGGAAGAAGG - Intronic
1151042877 17:70883945-70883967 GAAAAGAGCTGGAGGGAAGAAGG + Intergenic
1151480458 17:74367551-74367573 GTGATGTCCTGCAGGGAAGTGGG - Exonic
1151617598 17:75224484-75224506 GAGAAGGGGTGGGGGGAAGCAGG + Intronic
1151849040 17:76678898-76678920 GACAAGGGAGGCTGGGAAGTGGG - Intronic
1152017420 17:77760949-77760971 GAGAAGGGTGGCAGTGATGTGGG + Intergenic
1152244483 17:79177952-79177974 GAGACGGCCCCCAGGGAAGTTGG + Intronic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1152913043 17:83016490-83016512 GAGAAGGGATGGAGGGAGGAGGG + Intronic
1153322093 18:3783613-3783635 GGGGAGGGCTGGAGGGAAATGGG + Intronic
1154203595 18:12318264-12318286 GGGAAGGGGTGGAGAGAAGTTGG + Intronic
1156917887 18:42483310-42483332 GAGCAGGGCTCTAGGGAAGAAGG - Intergenic
1157259687 18:46167398-46167420 GAGAAGGCTTCAAGGGAAGTTGG - Intergenic
1157617346 18:48995065-48995087 GAGAAGGGGTCCTGGGAAGCAGG - Intergenic
1158306282 18:56109681-56109703 GAGAGGAGCAGCAGGGATGTGGG + Intergenic
1158661550 18:59393051-59393073 GAGAAGAGATGGAGGGAAATGGG - Intergenic
1158933295 18:62341969-62341991 GAGTTGGGCTTCAGGGAAGGAGG - Intronic
1159023909 18:63165782-63165804 GAGAAGGCTTGCAGGGGAGGGGG + Intronic
1159359413 18:67381417-67381439 GTGAGGGGCCGCAGGGAAGCGGG + Intergenic
1159623166 18:70662672-70662694 GAGAAGGGCAGAGGGTAAGTAGG - Intergenic
1160128487 18:76203060-76203082 GAGAGGGGCTGCAGTGAAGAAGG + Intergenic
1160128768 18:76205252-76205274 GAGAAGGGCGGAAGGGAGGGAGG + Intergenic
1160231586 18:77053224-77053246 GAGGACAGGTGCAGGGAAGTGGG - Intronic
1160686870 19:440989-441011 GCGAAGGGCTGCTGGGAAAAGGG - Intronic
1160752564 19:741400-741422 GAGACGGGCTGCAGGGGTGAGGG + Intronic
1160752572 19:741423-741445 GAGACGGGCTGCAGGGGTGAGGG + Intronic
1160752580 19:741446-741468 GAGACGGGCTGCAGGGGTGAGGG + Intronic
1160752588 19:741469-741491 GAGACGGGCTGCAGGGGTGAGGG + Intronic
1160752610 19:741530-741552 GAGACGGGCTGCAGGGGTGAGGG + Intronic
1160752618 19:741553-741575 GAGACGGGCTGCAGGGGTGAGGG + Intronic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1160997197 19:1888264-1888286 GGAAGGGGCTGCAGGGAAGATGG - Intergenic
1161222746 19:3125475-3125497 GAGAAATGGAGCAGGGAAGTGGG + Intergenic
1161849377 19:6730831-6730853 GAGAAGGGATGGAGGGGAGATGG - Intronic
1162567940 19:11454337-11454359 GGGAGGGTCTGCAGGGAATTGGG - Exonic
1162668410 19:12234986-12235008 GAGAAGGGTCTCAGAGAAGTGGG + Intronic
1162948740 19:14058352-14058374 GAGATGGGGTGCAGGGAGATGGG + Intronic
1163204911 19:15795235-15795257 GAGAAGGGAAAGAGGGAAGTAGG - Intergenic
1163209866 19:15832269-15832291 AAGAAGGGCTGCAAAGAAGAAGG - Intergenic
1163371355 19:16902931-16902953 GAGAAGGGCAGTGGGGAGGTGGG + Intronic
1163687077 19:18717739-18717761 GAGCAGGGCCGCAGGGACATGGG + Intronic
1164893910 19:31852387-31852409 GATAAGGGCTGCAAGCTAGTTGG - Intergenic
1165475112 19:36026075-36026097 GAGACCTGCTGGAGGGAAGTGGG + Intronic
1166118126 19:40667907-40667929 GGGAAAGGCTGCAGGGCAGGAGG + Exonic
1166449547 19:42886666-42886688 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166460845 19:42986962-42986984 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166478139 19:43146949-43146971 GTGAAGGGCTGGGTGGAAGTTGG - Intronic
1166774062 19:45301991-45302013 GACAAGGGCTCCAGGGAATCGGG - Intronic
1167477876 19:49711499-49711521 GAGAAGAGGTGCAGGGCAGGTGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168125654 19:54281099-54281121 GAGGAGAAATGCAGGGAAGTAGG + Exonic
1202715483 1_KI270714v1_random:40062-40084 GAAAAGGGCAGCAGGGAACAAGG + Intergenic
924995799 2:359311-359333 GATAAGGAGTGCAGGGCAGTGGG - Intergenic
925293103 2:2761541-2761563 GAGAAGGGCTGCAGGGTTATAGG - Intergenic
925466462 2:4110878-4110900 GAGAAGGGAAGGAGGGAAGGTGG - Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928789027 2:34928817-34928839 GAGAAGGGAGGAAGGGAAGGAGG - Intergenic
929219161 2:39445604-39445626 GAGAAAGGCTGAAGGGGATTTGG - Intergenic
929461545 2:42105644-42105666 AAGAAGAGTTGCAGGGAAGGGGG - Intergenic
930080519 2:47443487-47443509 GAGAAGGGCTGCAGCAAAGTGGG + Intronic
930434812 2:51327483-51327505 GAGAAAGTTAGCAGGGAAGTTGG - Intergenic
931424668 2:62159754-62159776 GGTAAGGGCAGGAGGGAAGTGGG + Intergenic
931965077 2:67523954-67523976 GTGCAGGGGAGCAGGGAAGTGGG - Intergenic
931975355 2:67638018-67638040 GAGAAGGGAAGAAGGGAAGAAGG + Intergenic
932495878 2:72145470-72145492 TAGAAGGGCTGCACGGCAGGGGG - Intronic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
932982069 2:76681333-76681355 GAGACAGGCTGCAAGGATGTTGG + Intergenic
933047384 2:77556549-77556571 AAGGAGGGCTGTAGGGCAGTGGG - Intronic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933711257 2:85327713-85327735 GAGAAGGGCAGGCGGGAAGAAGG + Intronic
933748906 2:85590692-85590714 GGGATGGGCTGTGGGGAAGTAGG + Intronic
934315369 2:91913243-91913265 GAGAAGGGAAGAAGGGAAGAAGG + Intergenic
935174556 2:100638438-100638460 GGGGAGGGCTGCAGGGATGCTGG - Intergenic
935648671 2:105363464-105363486 GTGATGGGCTGCAGGGACGAGGG + Exonic
935842655 2:107130159-107130181 GCCAGGGGCTGCAGGGAAGAGGG - Intergenic
936083502 2:109451271-109451293 AACAAGGGCTGCAGGGTAGAAGG - Intronic
936238549 2:110767451-110767473 GACAAAGTCTGCAGGCAAGTGGG + Intronic
936609844 2:113991562-113991584 GAGATGAGCTGCAGGCAGGTGGG + Intergenic
936662329 2:114556123-114556145 AAGAAGGGCAGCAGGGAGATGGG + Intronic
937248514 2:120509483-120509505 GAGGGAGGCTGCAGGGAAGGAGG + Intergenic
937355119 2:121193354-121193376 GAGAAGGTCTGCAGTGAAAAAGG - Intergenic
937408003 2:121648898-121648920 GAGAAGGGGTGCCGGGAGGCGGG - Intronic
938421653 2:131151761-131151783 GTGAATGGCTGGAGGGAAGGGGG + Intronic
938662188 2:133498522-133498544 GAAAAGGGCGGCAGGGAGGAAGG + Intronic
938995279 2:136671839-136671861 GAGAAGGGAGGGGGGGAAGTTGG + Intergenic
939141526 2:138359721-138359743 GTGAAGGGCTGTGGGGAAGGGGG + Intergenic
940899180 2:159110726-159110748 AAGATGGGCTCCAGGGAAGATGG - Intronic
941490460 2:166137158-166137180 GTGAAGGGCTGGTGGGAACTGGG + Intergenic
942676245 2:178429420-178429442 CAGAAGGGTTGCAGGAAAGTAGG - Intergenic
943175403 2:184466900-184466922 AGCAAGGGATGCAGGGAAGTAGG - Intergenic
943660950 2:190558655-190558677 GAGAAGGAGTGAAGAGAAGTAGG + Intergenic
944238071 2:197458437-197458459 AAGAAGAGATGCAGGGAAGAGGG - Intronic
946027086 2:216678471-216678493 GAGAAAAGCTGCAGGGGAGGGGG - Intronic
946068808 2:217013304-217013326 GAGAAGGGAGGCAGGTAGGTAGG + Intergenic
946194788 2:218026654-218026676 GAAAAGGGCTGGAGGGAGGTAGG - Intergenic
946283955 2:218688535-218688557 GAGAAGGAAAGCAGGGAAATAGG - Intronic
946447540 2:219752327-219752349 GGGAAGGGTAGCAGGAAAGTAGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947500879 2:230669823-230669845 GAAAAGGCCAGCAGGGAAGGGGG + Intergenic
947603401 2:231468327-231468349 GGGAGGTGCAGCAGGGAAGTTGG - Intronic
948297815 2:236875992-236876014 TCAGAGGGCTGCAGGGAAGTGGG + Intergenic
948715149 2:239856418-239856440 GGGAAGGGCTCCAGGCAAGGAGG + Intergenic
948741034 2:240046121-240046143 GGAAAGGGCTGCAGGGAAGCTGG + Intergenic
948817419 2:240519616-240519638 GGGAAGGGCTGCAGGAATCTGGG + Intronic
948995479 2:241576166-241576188 GAGTAGAGCTGCAGGGAAGGAGG - Intergenic
1168923226 20:1558342-1558364 GAGGAGGCCTGCAGGGAAGGCGG + Exonic
1169051450 20:2582030-2582052 GAGAAGGGAAGAAGGGAAATAGG + Intronic
1169110804 20:3032434-3032456 GGGAAGGGGTGCAGAGAAATAGG - Intronic
1169298512 20:4421373-4421395 GAAAAAGGCTGCAGTGAAGCCGG - Intergenic
1170569361 20:17624179-17624201 GGGAAGGACGGCAGGGAAGGAGG + Intronic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1171418442 20:24999756-24999778 GGGAGGGGCTGCAGGGATGCAGG + Intergenic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1172619038 20:36307432-36307454 GAGAAGGGCCGGAGGGATGGAGG - Intronic
1172800123 20:37570196-37570218 GGGAAGGGTTGCAGGGAGGCAGG - Intergenic
1173174540 20:40754541-40754563 GAGGAGGGCTGCAAGGGAGTGGG - Intergenic
1173265141 20:41472334-41472356 GAGAAGGGATGCAGGGAAGAGGG - Intronic
1173431241 20:42988679-42988701 GACAGTGGCTGCAGGGAAATAGG + Intronic
1173555132 20:43960563-43960585 GGGAAGTGCTATAGGGAAGTGGG - Intronic
1173712956 20:45176427-45176449 GGGAAGGGCAGCAGGGACTTAGG - Exonic
1176200490 20:63858203-63858225 GAAATGGGGTGCAGGGAAGGTGG - Intergenic
1177488870 21:21794985-21795007 GACACGGGCAGCAGGGAAGGAGG - Intergenic
1177968056 21:27753710-27753732 GAGAAGAGCAGCAGGGAGGAAGG - Intergenic
1178350129 21:31866925-31866947 GAGGTGGGGTGCAGGGGAGTGGG + Intergenic
1178737733 21:35167803-35167825 GAGATAGACTGCAGGGAAATGGG + Intronic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179383627 21:40921576-40921598 GAGAAGGGATCAAGAGAAGTTGG + Intergenic
1179427114 21:41290421-41290443 AAGCGGGGCTGCAGGGCAGTGGG - Intergenic
1179554145 21:42162032-42162054 GAGAAGGGGAGCAGGGAGGGGGG + Intergenic
1180167988 21:46040036-46040058 GGGAAGGGCTGGAGGGAGGGTGG - Intergenic
1180611361 22:17100327-17100349 GAGAAGGGAGGAAGGGAAGGTGG - Intronic
1180694827 22:17744924-17744946 GAGAAGGGTGGGAGGGAAGATGG + Intronic
1181086569 22:20442251-20442273 GAGAAGGACTGCTGGGAGGAAGG - Exonic
1181098145 22:20520242-20520264 GAGAAGGGCAGCGGGCACGTGGG - Intronic
1181588782 22:23869926-23869948 TAAAAGGGCTGGAGGGAACTAGG - Intronic
1181631079 22:24151731-24151753 GAGAGGGGTTGCAGGGAATCTGG - Intronic
1181999741 22:26910721-26910743 GACAAGGACAGCAGGAAAGTGGG - Intergenic
1182410428 22:30180825-30180847 GAGAAGGGAAGAAGGGAAGGGGG - Intergenic
1182439464 22:30354284-30354306 CAGATGGGAGGCAGGGAAGTGGG - Intronic
1182757339 22:32690669-32690691 GTGGAGGGATGCAGGGAAGGTGG - Intronic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183723681 22:39576779-39576801 GAGGAGGGCGGCCGGGAAATGGG - Intronic
1183899580 22:40994912-40994934 GGGGAGGGGTGCTGGGAAGTGGG + Intergenic
1184279092 22:43426948-43426970 GGGAGGGGCTGCAGGGATGGGGG + Intronic
1184298867 22:43543335-43543357 GAGAAGGGCTGGGGGCAGGTGGG - Intronic
1184301160 22:43561933-43561955 GAGCAGGGCTGCAGGAAAGGCGG + Intronic
1184543286 22:45145137-45145159 GCTAAGGGCTGCAGGGAGGGGGG - Intergenic
1184824095 22:46935437-46935459 GACAGGGGCTGCGGGGGAGTGGG - Intronic
1184921762 22:47610205-47610227 GGAAAGGTCTTCAGGGAAGTGGG + Intergenic
1185095412 22:48803633-48803655 GAGGAGGGCAGCTGGGAAGATGG + Intronic
1185112336 22:48907321-48907343 GAGATGGGCAGCAGGGCAATGGG - Intergenic
1185344775 22:50306489-50306511 GAGCGAGGCTGCCGGGAAGTGGG - Intronic
949819127 3:8096021-8096043 GAGGAGGGCTGCAGGAATCTGGG + Intergenic
950322518 3:12070188-12070210 GAGCAGGGCGGCAGAGCAGTAGG - Intronic
950439956 3:13004730-13004752 GTGAGGGGCTGCAGGGATGGAGG + Intronic
950728150 3:14932634-14932656 GAAGAGGGCAGCAGTGAAGTAGG + Exonic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952078763 3:29731538-29731560 AAGAAGGACTGCAAAGAAGTAGG - Intronic
953611864 3:44453970-44453992 GAGATGGGAGGCAGGGAAGATGG - Intronic
953867434 3:46596353-46596375 GAGGAGGCCTGCAGGGGAGCAGG - Intronic
954706391 3:52482996-52483018 GAGAAGGTCTGCAGTGGAGGTGG + Intronic
956352544 3:68353592-68353614 AACAATGGCTGCAGGGAAGTAGG + Intronic
958639271 3:96783930-96783952 GAGAGGGGCTGAAAAGAAGTTGG - Intergenic
958941894 3:100326076-100326098 GGTAAGGGCTGGAGGGAAGAGGG - Intergenic
959154306 3:102648117-102648139 AAGAAAGGCTGCAGTGAAGAGGG - Intergenic
959305099 3:104653337-104653359 GAGAAGGGGTGAAGAGAGGTTGG - Intergenic
959769450 3:110074892-110074914 GTGAAGGAATGCAGGGCAGTAGG + Intergenic
960024028 3:112988201-112988223 GGGAAGTGGGGCAGGGAAGTGGG - Intergenic
960030661 3:113051466-113051488 GAGGAGGGCTGCAACGTAGTAGG - Intergenic
960926893 3:122803310-122803332 GAGAAGAGCTTCAGGAAGGTAGG + Intronic
960953356 3:123013809-123013831 GGGAAAGGCTTCAGGGAAGAGGG + Intronic
961170126 3:124791659-124791681 AAGACAGGCTGCAGGGAAGAGGG + Intronic
961408984 3:126704589-126704611 GACATGGGCTTCAGGGAAGGAGG + Intronic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
961816360 3:129552698-129552720 AACAAGGGCTGCAGGGTAGATGG + Intergenic
961919567 3:130411837-130411859 GAGGAGGTCAGCAGGGAAATGGG - Intronic
962990342 3:140572245-140572267 GAGGAGCTCTCCAGGGAAGTAGG + Exonic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964646973 3:158968957-158968979 GAGATGGGGTGAAGGGAAGAAGG + Intronic
965277248 3:166701302-166701324 GGGAAGGGCAACAGAGAAGTGGG + Intergenic
965728781 3:171747440-171747462 GAGAAGAGAGGCAGGGAAGAAGG - Intronic
965745991 3:171926471-171926493 GAGAAGGGTAGTAGGGAAGTGGG + Intronic
966128778 3:176610815-176610837 GAGCAGAGGTGCAGGGAACTTGG + Intergenic
966266046 3:178044669-178044691 GAGAAGGGATTGGGGGAAGTAGG + Intergenic
966669352 3:182509357-182509379 GGGAAGGGCAGCAGGGAAGGGGG + Intergenic
967966003 3:194960749-194960771 GAGAGGGGCGGCAGGTAAGGGGG + Intergenic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
968936576 4:3614246-3614268 GAGCTGGGCTGCAGGGAGGTGGG - Intergenic
969297371 4:6277910-6277932 GAGAAGGACTGCAGAGGAGTGGG - Intronic
969682910 4:8653074-8653096 GAGAAGGGCAGGAGGGAGGGAGG - Intergenic
969705757 4:8790325-8790347 GAGAGGGGCAGCAGGGATGTGGG - Intergenic
969948008 4:10804767-10804789 GAATAAGGGTGCAGGGAAGTGGG - Intergenic
970246213 4:14066523-14066545 GAGAAGGGCTGCTGAGGTGTGGG + Intergenic
971537378 4:27770895-27770917 AAGAAAGGCTGCAGGGAGTTTGG + Intergenic
972251791 4:37309587-37309609 GAGAATGGCTGGGGGGAGGTGGG + Intronic
972996650 4:44887410-44887432 GGGAAGAGTTGCAGGGTAGTAGG - Intergenic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
973658153 4:53072757-53072779 GAGAAGGGTCCCAGGGAAATCGG - Intronic
974694024 4:65341045-65341067 GAGGAGGGATGAAGGGAAGCCGG - Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
976230715 4:82840264-82840286 AAAAAGTGGTGCAGGGAAGTAGG - Intronic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
977294127 4:95192595-95192617 GAGAAGGTGAGCAGGGAAGGAGG - Intronic
978826249 4:113027474-113027496 TAGAAGGGCTGCAGGTAAACAGG - Intronic
981608546 4:146567039-146567061 GAGCAGAGATGCAGGCAAGTAGG - Intergenic
981802135 4:148670216-148670238 GAACAGGGATGCAGGGAAGCAGG + Intergenic
981813007 4:148796656-148796678 GAAAAGGACCTCAGGGAAGTTGG + Intergenic
981957101 4:150491000-150491022 CAGAAGGGCTGCATGGAAAATGG - Exonic
982030301 4:151293906-151293928 GACAAGGGCAGCAGGGGAGAGGG - Intronic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
982321039 4:154077846-154077868 GAGAAGGGCAGGAGGGAAATGGG + Intergenic
982440754 4:155433049-155433071 GGGAAGGGATGAAGAGAAGTGGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983904186 4:173168252-173168274 GACAAGGGGCTCAGGGAAGTGGG + Intergenic
984613075 4:181863615-181863637 GAGAAAGGCTTAAGGGAACTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
986234217 5:5892663-5892685 GAGAAGGACTGCTGGGGAGTCGG + Intergenic
986486350 5:8242282-8242304 GAAAAGGGCAGAATGGAAGTTGG - Intergenic
986573634 5:9190612-9190634 GATAGGGGCTGCAGGGAGGATGG - Intronic
986626577 5:9728630-9728652 GATGAGAGCTGCTGGGAAGTAGG + Intergenic
986694371 5:10338980-10339002 GGGAAGGGCAGGAGGGAAGTTGG + Intergenic
986995513 5:13602736-13602758 GGGAAGGGATGCAGGAAAGGGGG + Intergenic
987213601 5:15709880-15709902 CAAAAGGGCTCCAGGGAATTAGG - Intronic
988183901 5:27835443-27835465 GAAGAGGGCTGCAGGAAATTGGG + Intergenic
988496580 5:31750760-31750782 GAGAGGGGCTGCCGGGCACTTGG + Intronic
989214636 5:38891941-38891963 GAGAAGGGCGGCAGGGGTGGGGG - Intronic
991923240 5:71678709-71678731 GAGGTGGGCTGCAGGGATGTAGG - Intergenic
992014484 5:72561585-72561607 GATAAGGGTTGCAGGGAAGCAGG - Intergenic
992408371 5:76481022-76481044 TAAAAGGGCTGGAGGGAACTAGG - Intronic
993392972 5:87344064-87344086 GGGAAGGGTAGCAGGGAAGGGGG + Intronic
995308365 5:110681331-110681353 GAGCAGGGCAGCAGGAAGGTGGG + Intronic
995717094 5:115091040-115091062 AGGCATGGCTGCAGGGAAGTTGG - Intergenic
996102883 5:119463001-119463023 GGGAAGGGTAGCAGGGAAGAGGG - Intronic
996185228 5:120465470-120465492 GAGTAGGGCTGAACCGAAGTGGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997411847 5:133696715-133696737 AAGAAGGGCTGTGGGGAAGGAGG + Intergenic
997852629 5:137346316-137346338 GAGGAGGGGTGCAGGGAAGGAGG - Intronic
997930583 5:138069489-138069511 GAGAGGGGATGCAGGGAAATGGG - Intergenic
998005021 5:138651118-138651140 GAGAGGAGCAGCAGGGAAGCTGG - Intronic
998069620 5:139186940-139186962 AAGAAATGCTTCAGGGAAGTAGG + Intronic
998449094 5:142220672-142220694 GAATTGGGCTGTAGGGAAGTCGG - Intergenic
999236214 5:150097326-150097348 GAGAAGGGAGGAAGGGAGGTAGG + Intronic
999484140 5:151977522-151977544 GAGTAGGGGTGCAGGGAAACAGG - Intergenic
999505460 5:152190336-152190358 GAGAAGAGGTGAAAGGAAGTGGG - Intergenic
999697358 5:154198851-154198873 GGGCAAGGCTGCAGGGAAGAAGG - Intronic
1000345537 5:160311129-160311151 GAGAAGGGCTGAGGGGCATTGGG - Intronic
1000661751 5:163947404-163947426 GAGAAGTGATTCAGGAAAGTGGG - Intergenic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002977935 6:2104154-2104176 GTGAAGGGCTGAGGGGCAGTAGG - Intronic
1003244731 6:4374274-4374296 AAGAAAATCTGCAGGGAAGTTGG - Intergenic
1003351660 6:5323682-5323704 GGGAAGAGCTGGAGGGAAGCTGG + Intronic
1003551735 6:7107390-7107412 GCGAGGGGCTGCAGGGGAGGGGG + Intergenic
1004534805 6:16490285-16490307 GAAAAAGACTGAAGGGAAGTTGG - Intronic
1005010356 6:21330037-21330059 GACAAAGACTACAGGGAAGTTGG + Intergenic
1006170977 6:32092422-32092444 GAGAAGTGCTTCTGGGAAGAGGG + Intronic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1006785938 6:36667339-36667361 TTTCAGGGCTGCAGGGAAGTGGG + Intergenic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007701310 6:43768103-43768125 GAGAAGGGATGCAAGGGAGGGGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008949628 6:57141869-57141891 GAGAAGGGCTGAGGGGAGGAAGG + Intronic
1009686403 6:66963194-66963216 TAAAAGGGCTGAAGGGAACTAGG + Intergenic
1009815542 6:68729165-68729187 GAGAAGGGCAACAGGGCAGAGGG - Intronic
1010188342 6:73167834-73167856 TAGAAGGGCTGGAGTGAACTAGG - Intronic
1011014234 6:82736938-82736960 GAGAAGGGCTCCAAGGGTGTCGG - Intergenic
1012427718 6:99132201-99132223 GGGAAGGGCTGGATGGGAGTGGG - Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1013414568 6:109913274-109913296 GAGAAGGGCTCTGGGGAACTGGG - Intergenic
1014345912 6:120268740-120268762 GACAGGGGGTGCAGGGCAGTGGG - Intergenic
1014534702 6:122600787-122600809 GAGTAGGCATGCAGGGAAGCAGG + Intronic
1014897787 6:126924426-126924448 GATAAGGGCTGGAGTGTAGTGGG + Intergenic
1015456359 6:133431113-133431135 GAGATGGGATGTAGGGAATTGGG + Intronic
1016318734 6:142819015-142819037 AAGAAGGGAGGCAGGGAAGAAGG + Intronic
1016904032 6:149131484-149131506 AGGAAGGGCAGCTGGGAAGTTGG + Intergenic
1017119137 6:151007304-151007326 CTGAAGCCCTGCAGGGAAGTGGG - Intronic
1017716017 6:157213714-157213736 GAGATGGGCTGCAGTGCTGTGGG + Intergenic
1017993627 6:159511386-159511408 GAGCAGGGCTGCTGGGGAGCTGG + Intergenic
1018183375 6:161243708-161243730 GAGAAGGGGTCAAGGGAAGGAGG - Intronic
1019165197 6:170093980-170094002 GCAATGGGCTGCAGGGGAGTGGG + Intergenic
1019404922 7:877952-877974 GAGGAGGGAGGCAGGGAGGTGGG - Intronic
1019795294 7:3044009-3044031 GAGGAGGGCGGCAAGGAGGTGGG + Intergenic
1020220500 7:6232940-6232962 GCAGAGGGCTGCAGGGAGGTAGG - Intronic
1020355832 7:7274606-7274628 GAGCTGGGATGCTGGGAAGTAGG + Intergenic
1020787823 7:12591954-12591976 GAGAGGGGCTGCAAAGAAGAAGG + Intronic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1021476959 7:21073151-21073173 GAGGAGGGTTGCAGGGGAATGGG + Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021610495 7:22453065-22453087 GAGAAAGACTGCAGGGGAGTTGG - Intronic
1022139041 7:27476226-27476248 GAGAAGGGTAGCAGAGGAGTGGG - Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022765862 7:33410609-33410631 AAGAAGGACAGCAGGAAAGTTGG - Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023113070 7:36833809-36833831 GAGAAGCACTGCATGGAAGCTGG - Intergenic
1024366122 7:48522285-48522307 GGGAAGGACAGCAAGGAAGTGGG - Intronic
1024427177 7:49239826-49239848 GTGAATGCCTGCAGGGAAGCAGG - Intergenic
1024969956 7:55059902-55059924 GATAAGGGCTGGGTGGAAGTAGG + Intronic
1025606667 7:63044517-63044539 TAGTAGGGATGCAGGGAAGGGGG - Intergenic
1026396943 7:69964974-69964996 GACAAGAGCTTCAGGGAACTGGG - Intronic
1026539836 7:71270038-71270060 GTGTAGGGCAGCAGGGAGGTAGG - Intronic
1026551570 7:71373367-71373389 GTGAAGGGAGGCAGGGAGGTTGG + Intronic
1026775850 7:73230553-73230575 AAGGAGGGCTGCCTGGAAGTGGG + Intergenic
1026877963 7:73890553-73890575 GAGGGGGTCTGCAAGGAAGTGGG - Intergenic
1027016708 7:74783925-74783947 AAGGAGGGCTGCCTGGAAGTGGG + Intronic
1027071320 7:75162011-75162033 AAGGAGGGCTGCCTGGAAGTGGG - Intergenic
1027763496 7:82308956-82308978 GAGAAGGGCTATTTGGAAGTTGG + Intronic
1028465359 7:91145500-91145522 GAGAAGGGGTGGAGGGGAGAAGG - Intronic
1028530257 7:91830925-91830947 GAGAAGGAAGGCAGAGAAGTGGG - Intronic
1029033931 7:97498577-97498599 GAGAAGGGGAGCCGGGAGGTTGG + Intergenic
1029203016 7:98851616-98851638 GAGGAGGGCTGCAGGGAAATGGG + Exonic
1030154942 7:106445426-106445448 GGGAAGGGGAGTAGGGAAGTGGG - Intergenic
1030154960 7:106445498-106445520 GGGAAGGGGAGTAGGGAAGTGGG - Intergenic
1031359713 7:120834451-120834473 GATGAGGGCTGCAGGGAGGCTGG + Intronic
1031584650 7:123519642-123519664 GAGAAGGGCAGGAGGGAGGAAGG + Intronic
1031723430 7:125206605-125206627 GAAAAGAGGTGCAGGTAAGTCGG + Intergenic
1032452907 7:132049757-132049779 GAGAAGGGGTCCAGAGAAGAAGG + Intergenic
1033926553 7:146469218-146469240 GAGAAGGGTTGCTGTGATGTGGG - Intronic
1034413918 7:150955287-150955309 GGAGAGGGCTGCTGGGAAGTAGG - Intronic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1035389579 7:158496345-158496367 GGGAAGGGGCGCAGGGAAGGGGG - Intronic
1035389721 7:158496686-158496708 GGGGAGGGGTGCAGGGAAGGGGG - Intronic
1035389818 7:158496917-158496939 GGGAGGGGGTGCAGGGAAGGGGG - Intronic
1035389926 7:158497171-158497193 GGGAAGGGGTACAGGGAAGGGGG - Intronic
1036143250 8:6227519-6227541 GAGGGGGGCAGCAGGGCAGTGGG - Intergenic
1036384886 8:8270289-8270311 GAGAAGGCCTGCTGGGAAAGGGG + Intergenic
1036694040 8:10963165-10963187 GAGAAGGCCAGCGGGGAAGTGGG - Intronic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036924711 8:12893059-12893081 CAGCAGGGCTGCAGAGAACTGGG + Intergenic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1037676995 8:21059499-21059521 GAGAAGAGCTACAGGGAATGGGG - Intergenic
1037774381 8:21823303-21823325 GAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1039917008 8:41867550-41867572 GAAAAGGCCTGCAGGGAACAGGG - Intronic
1040488310 8:47895624-47895646 GGGAAGGGCTGGAGGGCAGTGGG - Intronic
1040496561 8:47970679-47970701 GGGAAGGGCTCCAGTGCAGTTGG + Exonic
1040869272 8:52083606-52083628 GAGATAGTCTCCAGGGAAGTTGG + Intergenic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1041148187 8:54902178-54902200 GAGAAGAGCTGCAGGATAGGAGG + Intergenic
1041321494 8:56618558-56618580 GAGAAGGGGAGAAGGGAAGAAGG - Intergenic
1041576199 8:59398430-59398452 GAGAAGGGTTTCTGGGAAGATGG + Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042502283 8:69522670-69522692 GAGAAGAGCTCCAGTAAAGTAGG + Intronic
1042669600 8:71246966-71246988 GAGAAGTTCTGGAGGGATGTGGG - Intronic
1042679633 8:71368435-71368457 GAGAGTGGATGCAGGGGAGTGGG + Intergenic
1042871972 8:73407794-73407816 GTGAAGGCCTGCAGGAAAGTCGG - Intergenic
1043322664 8:79009389-79009411 GAGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043770873 8:84198641-84198663 GGGAAGGGTGGCAGGGAGGTGGG - Intronic
1044229394 8:89757578-89757600 GGGACGGGCGGCTGGGAAGTGGG - Intergenic
1044853169 8:96448780-96448802 GAGAAGGGCTGCCAGGAAAAAGG + Intergenic
1045497002 8:102717433-102717455 GAGAAGGGCTGCAGGGGATGGGG - Intergenic
1045808680 8:106195887-106195909 GAGAAGGGTAGCAGGGAAGGGGG + Intergenic
1047800045 8:128299648-128299670 GAGAAGGGCAGGAGGGTAGGGGG - Intergenic
1049139950 8:140945003-140945025 GAGAGGGCAAGCAGGGAAGTTGG - Intronic
1049588094 8:143441128-143441150 GAGAAGGGGTGCAGGTGGGTGGG + Intronic
1049693951 8:143974678-143974700 GGGGAGGGCAGGAGGGAAGTGGG - Intronic
1049848716 8:144819429-144819451 GGGAAGGGCTGCAGGAAAGGAGG - Intergenic
1052381305 9:27773801-27773823 CAGAAGGGCTGCAGTGAGTTTGG - Intergenic
1053163038 9:35826787-35826809 GAGAAGGCCAGCAGGCAGGTGGG - Intronic
1053650573 9:40164647-40164669 GCAAGGGGCTACAGGGAAGTAGG - Intergenic
1053755165 9:41299277-41299299 GCAAGGGGCTACAGGGAAGTAGG + Intergenic
1054331083 9:63756418-63756440 GCAAGGGGCTACAGGGAAGTAGG - Intergenic
1054534010 9:66211555-66211577 GCAAGGGGCTACAGGGAAGTAGG + Intergenic
1055354740 9:75426342-75426364 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1056450592 9:86712861-86712883 GAGAAGGAATGCAAGGGAGTGGG + Intergenic
1057190424 9:93084153-93084175 GAGAAGGGATGCTGGGGAGCAGG - Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057817509 9:98306440-98306462 GAGGTGGGCTGCAGGGAGGGAGG + Intronic
1059329730 9:113527237-113527259 GATGAGAGCTGCAGGGAAATAGG - Intronic
1060081246 9:120648383-120648405 AAGAAGGGTTGAAAGGAAGTAGG - Intronic
1060672531 9:125482275-125482297 GAGAAGGGCTTCTGGGAAGCTGG - Intronic
1060731076 9:126037381-126037403 GAGTCGGTCTGCAGGGAACTTGG + Intergenic
1060810559 9:126609660-126609682 GAGAGGGGCTGCAGGGAGACAGG - Intergenic
1060985382 9:127816457-127816479 GAGCAGAGCTGCAGGGCACTCGG - Intronic
1061213923 9:129209313-129209335 GAGGAGGGCTGCAGAGAGGGAGG + Intergenic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062051603 9:134450168-134450190 GAGATGGGCAGCAGGCAAGGAGG - Intergenic
1062144086 9:134979180-134979202 AAGGAGGGAGGCAGGGAAGTAGG + Intergenic
1062478796 9:136742188-136742210 GAGCAGGGCTGCAGAGAAGCAGG + Intronic
1202798457 9_KI270719v1_random:149338-149360 GCAAGGGGCTACAGGGAAGTAGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1186188219 X:7042530-7042552 GTGAAGGGCTGGGTGGAAGTTGG - Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186448233 X:9650395-9650417 AAGAAGGGCAGCTGGGAAGCTGG + Intronic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1187505404 X:19874802-19874824 GAGAGGGGGTGCAGGGGAATGGG + Intronic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1187795043 X:22994490-22994512 AAGAAGGGCCGAAGGGAGGTTGG - Intergenic
1187982324 X:24770697-24770719 AAGAAGGGTGGCAGGGAAGGGGG + Intronic
1188465361 X:30473370-30473392 GGGAAGGGAAGCAGGGAAGGGGG + Intergenic
1189104126 X:38219870-38219892 GCGAAGAGCTTCAGGGGAGTAGG - Intronic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189249952 X:39593110-39593132 GAGAAAGACTGAAGGGAGGTTGG - Intergenic
1189615372 X:42778088-42778110 GAGAAGGGCTGCGAGAGAGTTGG + Intergenic
1189724647 X:43955785-43955807 GAGATGGGCAGCAGGGACCTAGG + Intronic
1189999184 X:46668733-46668755 GCCAGGGGCTGCAGGGAAGGGGG + Intronic
1190245384 X:48687338-48687360 GAGAAGGGCTGGTGGGTAGGTGG + Intronic
1190332084 X:49242304-49242326 GAGAGGGGCTACAGGGCAGGGGG + Intronic
1191072993 X:56421633-56421655 GAGAGTGGGTGCAGGGGAGTGGG - Intergenic
1191911925 X:66160680-66160702 GTGGAGGGGTGCAGGGAAGAGGG - Intergenic
1192544118 X:71998583-71998605 GTGAAGGGCTGGAGAGAAGGGGG + Intergenic
1193278264 X:79617322-79617344 TTAAATGGCTGCAGGGAAGTGGG + Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1194102237 X:89719678-89719700 AAGAAGGGAGGCAGAGAAGTTGG - Intergenic
1195112201 X:101659414-101659436 TAGAAGGCCAGCAGGGAGGTTGG - Intronic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1195388252 X:104333996-104334018 GAGCAGAGATGCAGGTAAGTTGG + Intergenic
1195522230 X:105844580-105844602 CTGAAGGGCCTCAGGGAAGTAGG - Intronic
1198107871 X:133478070-133478092 GAGAAGTGCTGCAGCAAAGCAGG + Intergenic
1198215326 X:134549771-134549793 GAGAGGAGCTGTAGGGAAGGGGG + Intergenic
1199622054 X:149710946-149710968 GGGAAGAGTGGCAGGGAAGTTGG + Intronic
1199788911 X:151131309-151131331 GGGCAGGGGTGCAGGGAACTGGG - Intergenic
1200180944 X:154150359-154150381 GAAGAGGGGAGCAGGGAAGTGGG + Intronic
1200186587 X:154187473-154187495 GAAGAGGGGAGCAGGGAAGTGGG + Intergenic
1200192239 X:154224611-154224633 GAAGAGGGGAGCAGGGAAGTGGG + Intronic
1200197994 X:154262415-154262437 GAAGAGGGGAGCAGGGAAGTGGG + Intronic
1200248884 X:154541829-154541851 GACAAGGGCTGCAGCGATTTCGG - Intronic
1200273867 X:154713375-154713397 GAGGATGGCTGCAGGGAGGAGGG + Exonic
1200695775 Y:6357891-6357913 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1201039502 Y:9816819-9816841 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic