ID: 904616711

View in Genome Browser
Species Human (GRCh38)
Location 1:31753949-31753971
Sequence TTTTAGGGAGGGCCCCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904616711_904616722 12 Left 904616711 1:31753949-31753971 CCCTACAGGGGCCCTCCCTAAAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 904616722 1:31753984-31754006 GAAACATGCCAAGTAGGACAAGG 0: 1
1: 0
2: 0
3: 16
4: 166
904616711_904616724 14 Left 904616711 1:31753949-31753971 CCCTACAGGGGCCCTCCCTAAAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 904616724 1:31753986-31754008 AACATGCCAAGTAGGACAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 124
904616711_904616720 6 Left 904616711 1:31753949-31753971 CCCTACAGGGGCCCTCCCTAAAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 904616720 1:31753978-31754000 CCCAAGGAAACATGCCAAGTAGG 0: 1
1: 0
2: 4
3: 15
4: 169
904616711_904616726 26 Left 904616711 1:31753949-31753971 CCCTACAGGGGCCCTCCCTAAAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 904616726 1:31753998-31754020 AGGACAAGGGGCAAGAGCAGAGG 0: 1
1: 0
2: 8
3: 83
4: 736
904616711_904616723 13 Left 904616711 1:31753949-31753971 CCCTACAGGGGCCCTCCCTAAAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 904616723 1:31753985-31754007 AAACATGCCAAGTAGGACAAGGG 0: 1
1: 0
2: 0
3: 19
4: 194
904616711_904616715 -10 Left 904616711 1:31753949-31753971 CCCTACAGGGGCCCTCCCTAAAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 904616715 1:31753962-31753984 CTCCCTAAAAAGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904616711 Original CRISPR TTTTAGGGAGGGCCCCTGTA GGG (reversed) Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
901772516 1:11537464-11537486 TTTGGGGGATGGCCCCTGTGGGG + Exonic
903569488 1:24293877-24293899 GTTTGGGGAGGGCCCCAGCAGGG - Intergenic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
905462413 1:38130299-38130321 TCATAGGGAAGGCCCCTGGAGGG + Intergenic
907795729 1:57714754-57714776 TTTAAGGGAGGGCCCTTGTAGGG + Intronic
911117430 1:94260326-94260348 TTTGAGGCAGGGCCCCTCTGGGG - Intronic
913162399 1:116156105-116156127 TTTTAGGGAAGGCAATTGTATGG - Intergenic
915239346 1:154508773-154508795 TTTTAGGAAGGGACCTTGTTAGG + Intronic
921730101 1:218568276-218568298 TCTTAGGAAAGACCCCTGTAGGG + Intergenic
1063264024 10:4425770-4425792 ATTTAGGTAAGGCACCTGTAGGG + Intergenic
1068108974 10:52655861-52655883 TCTTAGGGAGGGATCCTGGAAGG + Intergenic
1069138433 10:64794517-64794539 ATTTAGGGAGGATCCCAGTATGG + Intergenic
1069900894 10:71706067-71706089 TTTAAGAGAGGACCCCTGGAGGG + Intronic
1072027369 10:91474849-91474871 GCTCAGGGAGGGCCTCTGTAAGG + Intronic
1073549267 10:104382304-104382326 CCTTAGGGAGGGGCCCTGTAGGG + Intronic
1076292052 10:129353029-129353051 TTGTAGGGAGCTTCCCTGTATGG + Intergenic
1077135349 11:995406-995428 TGTCAGGGAGGGCTCCTGTCGGG + Intronic
1077458835 11:2698813-2698835 TTTTAGGTAGGGCCTCATTAGGG - Intronic
1077573185 11:3356364-3356386 ATTTTTGGAGGGCCTCTGTAAGG + Intronic
1080368743 11:31609464-31609486 ATTTTTGGAGGGCCTCTGTAAGG + Intronic
1085131943 11:74047612-74047634 TTGTAGGAAGGGCTGCTGTAGGG + Intronic
1087307459 11:96502930-96502952 TTTTAGGATGGGCCCATGTGAGG - Intronic
1088669676 11:112128912-112128934 TGAGAGGGAGGGCCCCTGTGTGG + Intronic
1089284765 11:117398443-117398465 TATTAGGCAGTGCCCCAGTAGGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090316700 11:125797467-125797489 TATTAGGCAGTGCCCCAGTAGGG + Intergenic
1095624482 12:44298804-44298826 TTTTAGAGGTGGTCCCTGTATGG + Intronic
1097196621 12:57245668-57245690 TTTTAGGGAAAGTCCCTGCATGG - Intronic
1104099809 12:125596566-125596588 TTTTGAGGAGGGGCCCTTTAAGG - Intronic
1104115423 12:125744797-125744819 TTGGAGGGAGGGCCCTGGTAGGG + Intergenic
1104910992 12:132240946-132240968 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911008 12:132240991-132241013 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911021 12:132241036-132241058 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911034 12:132241081-132241103 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911047 12:132241126-132241148 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911077 12:132241216-132241238 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911092 12:132241261-132241283 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911107 12:132241306-132241328 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911122 12:132241351-132241373 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911138 12:132241396-132241418 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911154 12:132241441-132241463 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911168 12:132241486-132241508 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911183 12:132241531-132241553 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911199 12:132241576-132241598 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911214 12:132241621-132241643 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911230 12:132241666-132241688 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911243 12:132241711-132241733 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911275 12:132241801-132241823 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911304 12:132241891-132241913 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911320 12:132241936-132241958 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911335 12:132241981-132242003 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911351 12:132242026-132242048 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911394 12:132242161-132242183 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911425 12:132242251-132242273 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911441 12:132242296-132242318 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911472 12:132242386-132242408 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911485 12:132242431-132242453 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911516 12:132242521-132242543 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911532 12:132242566-132242588 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911548 12:132242611-132242633 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911564 12:132242656-132242678 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911580 12:132242701-132242723 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911596 12:132242746-132242768 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911627 12:132242836-132242858 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911655 12:132242926-132242948 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911671 12:132242971-132242993 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911687 12:132243016-132243038 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911703 12:132243061-132243083 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911719 12:132243106-132243128 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911735 12:132243151-132243173 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911749 12:132243196-132243218 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911765 12:132243241-132243263 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1107723103 13:43270145-43270167 TTTTAAGCAGGGCCACTGTATGG + Intronic
1110778652 13:79439290-79439312 TTCTGGTGAGGGCCCTTGTATGG + Intergenic
1119681570 14:76596131-76596153 TTTTAGTGAGGGCCATTGTTAGG - Intergenic
1126009350 15:44288238-44288260 TTTTCGCGAGGGCCAGTGTAGGG + Intergenic
1128877735 15:71215672-71215694 TTTTAGGGAGGCCTCCTAGAGGG + Intronic
1132733539 16:1374763-1374785 TTTTTGGGATGCCCCCTGTGTGG - Intronic
1136709981 16:32229014-32229036 TTCTAGGCAGTGCCCCAGTAGGG - Intergenic
1136757928 16:32700397-32700419 TTCTAGGCAGTGCCCCAGTAGGG + Intergenic
1136810178 16:33169978-33170000 TTCTAGGCAGTGCCCCAGTAGGG - Intergenic
1136816654 16:33280058-33280080 TTCTAGGCAGTGCCCCAGTAGGG - Intronic
1137006207 16:35276256-35276278 TCTGAGGGAGGGCCCTTGTCAGG + Intergenic
1138480898 16:57302779-57302801 GGTTAGGGAGGGCCTCTGTGAGG + Intergenic
1144653012 17:17018891-17018913 GTCTAGGGAGGGGCCCTGGAGGG - Intergenic
1147323343 17:39658848-39658870 TTTCAGGGAGGGGCCTTGTGAGG + Intronic
1149250162 17:54759245-54759267 GTATAGGGTGAGCCCCTGTAGGG - Intergenic
1159209130 18:65293403-65293425 TTTTAGGAAGAGCCCCGCTAGGG - Intergenic
1167573859 19:50308353-50308375 ATCTAGGAAGGGCCCTTGTAGGG - Intronic
1168173732 19:54608086-54608108 GTTTGGGGAGGGTCCCTGGAAGG - Intronic
1168482963 19:56736975-56736997 GTTTAGGGAGGGTCCCAATAAGG - Intergenic
1168526137 19:57090196-57090218 CTGTAGGGAGGGCCCCTGGCTGG + Intergenic
927633552 2:24794285-24794307 CTTGAGGGAGGGCCAGTGTAGGG + Intronic
934610546 2:95732229-95732251 CACTAGGGAGGGCCCCAGTAGGG + Intergenic
1171052530 20:21873431-21873453 TGTTAGGGAGGGCTGCTGTAGGG - Intergenic
1176027902 20:62995413-62995435 CTTCAGTGAGGGCCCCTGTGGGG + Intergenic
1176196790 20:63840651-63840673 TGGTAGGGCGGGCCCCTGAAGGG - Intergenic
1179880623 21:44291983-44292005 GTTTAGGGAGGCCCCCGGCAGGG + Intronic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1181545259 22:23598794-23598816 TTGTATGGAGGGCGCCTGTATGG - Intergenic
1181689644 22:24551456-24551478 GGTTAGGCAGGGCCCCGGTAAGG - Intronic
1181815053 22:25431087-25431109 TTGTATGGAGGGCGCCTGTATGG + Intergenic
951384969 3:22031235-22031257 TTCTAGGCAGTGCCCCAGTAGGG + Intronic
957064027 3:75506525-75506547 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
963071467 3:141308601-141308623 TTTGAGGAAAGGCCCCTGGAAGG - Intergenic
963525652 3:146411217-146411239 ATCAAGGGAGGGCCCCTGTCAGG + Intronic
964883243 3:161447551-161447573 TTTTTGAGATGGCCCCTGGAGGG + Intergenic
965080283 3:164024206-164024228 ATTTTTGGAGGGCCTCTGTAAGG + Intergenic
969460916 4:7328504-7328526 TTTTAGTGAGGGCTCCTTGAGGG + Intronic
969745682 4:9069315-9069337 GTCAAGGGAGGGCCCCTGTCAGG - Intergenic
971114535 4:23629535-23629557 GTTGAGGGAGGGCCCCTGGTGGG + Intergenic
971598929 4:28568314-28568336 TATTAGACAGAGCCCCTGTAGGG + Intergenic
971875051 4:32297869-32297891 GTTGTGGGAGGGACCCTGTAGGG - Intergenic
978201610 4:106029146-106029168 TACTAGGGGGTGCCCCTGTAGGG - Intergenic
978875899 4:113639745-113639767 TTTTGGGGAGGGAGTCTGTATGG + Intronic
979132564 4:117066159-117066181 TTTTAGTGAGGTCACCTTTATGG + Intergenic
979137627 4:117128829-117128851 GTTAAGGGAGGGACCCAGTAGGG + Intergenic
981258678 4:142693372-142693394 TTTTAGGGTGGAGCCCTTTAAGG - Intronic
984099893 4:175472646-175472668 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
985027017 4:185748109-185748131 TTTTCGGGTGGCCCACTGTAAGG + Intronic
986462848 5:7990916-7990938 TTTTAGGAATGGCCCATGTAGGG + Intergenic
989477200 5:41888198-41888220 TTTTGGGGAGGTTCTCTGTAGGG + Intergenic
991762896 5:69940193-69940215 TTTTGGGGAGGGCCCTTTTGCGG + Intergenic
991784431 5:70177936-70177958 TTTTGGGGAGGGCCCTTTTGCGG - Intergenic
991842122 5:70815233-70815255 TTTTGGGGAGGGCCCTTTTGCGG + Intergenic
991876878 5:71178320-71178342 TTTTGGGGAGGGCCCTTTTGCGG - Intergenic
993098230 5:83505689-83505711 CAGTAGGGAGTGCCCCTGTAGGG + Intronic
993561693 5:89418027-89418049 TTCTAGGCAGGGCCCCAGTGGGG - Intergenic
998095061 5:139392152-139392174 TCTGAGGCAGGGCCCCTGGACGG - Exonic
1002948960 6:1789375-1789397 ATTCATGGTGGGCCCCTGTATGG - Intronic
1003650237 6:7952475-7952497 TTTTACGGAGAGACCCTGAAAGG + Intronic
1007086590 6:39151843-39151865 TATTAGGGAGCTCCCCTGTCTGG - Intergenic
1007485881 6:42180337-42180359 TTTTAGGGAGTACCCCAGTAAGG + Intergenic
1009005118 6:57775346-57775368 TTTTGGGGAGGGCCCTTTTGCGG - Intergenic
1009580563 6:65527808-65527830 GTTTAGGGAGGTCCCATGTGTGG - Intronic
1011312524 6:85995873-85995895 TCTTTTGGAGAGCCCCTGTAAGG + Intergenic
1012245700 6:96924156-96924178 TCCTAAGGAGGGCCACTGTAGGG + Intergenic
1012448385 6:99329619-99329641 ATGTAGCGAGGGCCCCTGTTTGG - Intronic
1017011741 6:150068171-150068193 CTTCAGGGAGGGTCCCTGAATGG + Intronic
1017676482 6:156819784-156819806 GTTCAGGGAGGGCTCCTCTAAGG + Intronic
1020328456 7:6994866-6994888 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
1022624524 7:32021093-32021115 TTCTATGGATGGCCCCAGTACGG - Intronic
1025875609 7:65477713-65477735 ATTTTTGGAGGGCCTCTGTAAGG - Intergenic
1034002663 7:147432805-147432827 GTTTAGGAAAGGCCTCTGTAGGG - Intronic
1036249277 8:7147795-7147817 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
1036368170 8:8139246-8139268 GTCAAGGGAGGGCCCCTGTCAGG - Intergenic
1036882715 8:12526401-12526423 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
1039607331 8:38892360-38892382 TTTGAGAGAGGGCCTCTCTATGG + Intergenic
1047650826 8:126918297-126918319 ATTTAGGGAGGGCCTCTCTCAGG + Intergenic
1055384659 9:75747991-75748013 CATTAGGCAGTGCCCCTGTAGGG - Intergenic
1197728521 X:129792236-129792258 TTCTAGGCAGGTCCCCTGGAAGG + Intronic
1199074536 X:143513176-143513198 TTTTAGGATGGGCCCATGTGAGG - Intronic
1199093542 X:143716448-143716470 TTTTAGGATGGGCCCATGTGAGG - Intronic
1199193761 X:145003102-145003124 TTTTTTGGAGGTTCCCTGTAGGG + Intergenic
1199207449 X:145165336-145165358 TTCAAGGGAGGGCCCCAGGATGG + Intergenic
1199214793 X:145251759-145251781 TTTTAGGATGGGCCCATGTGAGG + Intronic
1200981395 Y:9266103-9266125 TTTTCCAGAGGGCCCCTGTGAGG - Intergenic
1201274636 Y:12286189-12286211 GTTTTTGGAGGGCCTCTGTAAGG + Intergenic
1202129027 Y:21593631-21593653 TTTTCCAGAGGGCCCCTGTGAGG + Intergenic
1202178515 Y:22119505-22119527 TTTCAAAGAGGGCCCCTGAAAGG - Intergenic
1202178829 Y:22121997-22122019 TTTTGTGGAGGGCCCCAGCAAGG - Intergenic
1202212532 Y:22464397-22464419 TTTTGTGGAGGGCCCCAGCAAGG + Intergenic
1202212846 Y:22466889-22466911 TTTCAAAGAGGGCCCCTGAAAGG + Intergenic