ID: 904617865

View in Genome Browser
Species Human (GRCh38)
Location 1:31759746-31759768
Sequence CTGGCTATACACAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904617865_904617871 -8 Left 904617865 1:31759746-31759768 CCCTCCTGCCTGTGTATAGCCAG 0: 1
1: 0
2: 3
3: 16
4: 197
Right 904617871 1:31759761-31759783 ATAGCCAGGCCTGTCCTCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 192
904617865_904617872 -7 Left 904617865 1:31759746-31759768 CCCTCCTGCCTGTGTATAGCCAG 0: 1
1: 0
2: 3
3: 16
4: 197
Right 904617872 1:31759762-31759784 TAGCCAGGCCTGTCCTCCTGGGG 0: 1
1: 0
2: 1
3: 20
4: 196
904617865_904617878 11 Left 904617865 1:31759746-31759768 CCCTCCTGCCTGTGTATAGCCAG 0: 1
1: 0
2: 3
3: 16
4: 197
Right 904617878 1:31759780-31759802 TGGGGGCACTGATGACCCAGAGG 0: 1
1: 0
2: 1
3: 28
4: 254
904617865_904617873 -6 Left 904617865 1:31759746-31759768 CCCTCCTGCCTGTGTATAGCCAG 0: 1
1: 0
2: 3
3: 16
4: 197
Right 904617873 1:31759763-31759785 AGCCAGGCCTGTCCTCCTGGGGG 0: 1
1: 1
2: 3
3: 57
4: 332
904617865_904617870 -9 Left 904617865 1:31759746-31759768 CCCTCCTGCCTGTGTATAGCCAG 0: 1
1: 0
2: 3
3: 16
4: 197
Right 904617870 1:31759760-31759782 TATAGCCAGGCCTGTCCTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904617865 Original CRISPR CTGGCTATACACAGGCAGGA GGG (reversed) Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
900890964 1:5449393-5449415 CTGGCTTTGCAGATGCAGGAAGG + Intergenic
902400559 1:16154844-16154866 CTCGCTCTGCCCAGGCAGGAGGG + Intronic
903033931 1:20482302-20482324 CTGGCTGCAGACAGGAAGGAGGG - Intergenic
903592163 1:24465072-24465094 GTTGCTATACTCAGGCAGGCTGG - Intronic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
903801026 1:25968315-25968337 CTGATTATACACAGGAAGGTGGG + Intronic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
905470791 1:38190230-38190252 CTGACTATGCAGATGCAGGAAGG - Intergenic
906817384 1:48893000-48893022 CTGCATATACACAGACAGAAAGG + Intronic
911693224 1:100859013-100859035 CTGGCTAAACTCAGGCAGTCTGG + Intergenic
912385047 1:109267291-109267313 GTGGCTGGAGACAGGCAGGATGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
922692009 1:227700467-227700489 CTGGTGATACACAGGCAAAAAGG + Intergenic
923629240 1:235639030-235639052 CTGGCTTTAAAAATGCAGGAGGG - Intronic
1065158485 10:22894735-22894757 CTGGCTCTCCACATGCAGGTAGG + Intergenic
1065484556 10:26225254-26225276 CTGGTGATAAAAAGGCAGGATGG - Intronic
1066593932 10:37027757-37027779 CTCGCTACACACAGGCAAGATGG - Intergenic
1070167519 10:73909920-73909942 CTGCTTATCCTCAGGCAGGAAGG + Intronic
1070565505 10:77601069-77601091 TTGGCCCTTCACAGGCAGGAAGG + Intronic
1072258992 10:93649479-93649501 GTGGATATACACAGGAAGCATGG + Intronic
1072267327 10:93743236-93743258 GTAGCTATTCACAGGCATGATGG - Intergenic
1072300710 10:94059098-94059120 CTGGATAGACACAGTCATGATGG + Intronic
1072374425 10:94800306-94800328 CTGGTTATACCCAGGCAAAAAGG - Intronic
1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG + Intronic
1074730753 10:116372440-116372462 CTGAGTATAAATAGGCAGGAGGG - Intronic
1075653139 10:124143186-124143208 CTGGCTGTATCCAAGCAGGATGG - Intergenic
1075670834 10:124263112-124263134 CTGGAGAGACACAGGCAGGCAGG - Intergenic
1075680131 10:124325593-124325615 CAGCCTATACAAAGGCTGGAAGG - Intergenic
1077166901 11:1146375-1146397 CCGGCTCCACACAGCCAGGATGG - Intergenic
1077921397 11:6644483-6644505 TAGGCTCTGCACAGGCAGGAGGG - Intronic
1078237511 11:9499655-9499677 GTGGCTCTTCACAGGCACGATGG - Intronic
1082002556 11:47401089-47401111 CTGACTAGCCACATGCAGGAGGG - Intergenic
1082979108 11:59103717-59103739 CTGGCTGTACAACGGCAGAAAGG - Intergenic
1084901988 11:72316495-72316517 TTGGGTCTGCACAGGCAGGAGGG + Intronic
1091804616 12:3346849-3346871 CTGGGTATACCCTGGAAGGAAGG - Intergenic
1094035572 12:26066787-26066809 CTGGCTCTACCCAGGCTGGGTGG - Intronic
1096242929 12:49968854-49968876 CTAACTACACACAGGGAGGAGGG + Intronic
1097965991 12:65581897-65581919 CTGGTTTTAGGCAGGCAGGAAGG + Intergenic
1099908903 12:88805907-88805929 CTTGCTCTACAGAGGCAGGCTGG - Intergenic
1100748719 12:97673419-97673441 CTGGCAATACCCAGGCAAAAAGG + Intergenic
1101698280 12:107147488-107147510 CTGGCTAAGCACATGCAGGAAGG + Intergenic
1102195832 12:111024455-111024477 CTGCCAAGATACAGGCAGGAGGG - Intergenic
1102369345 12:112369081-112369103 ATGTCTATATATAGGCAGGAGGG - Intronic
1104795048 12:131511473-131511495 CTGTCTATTCAGAGACAGGACGG - Intergenic
1105981399 13:25519702-25519724 CTGGCTAGTCACAGCAAGGAGGG - Intronic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1106955032 13:34927969-34927991 CTGGCTACCCCCAGGAAGGAGGG - Intergenic
1107277259 13:38690517-38690539 CTGGCTATCAACAGGCAGGATGG - Exonic
1108091164 13:46851585-46851607 GTGGCTTTACAAGGGCAGGATGG + Intronic
1108530648 13:51324355-51324377 CTGACTATACACCCACAGGACGG + Intergenic
1110237121 13:73228433-73228455 CTGGTTATTCACATACAGGATGG - Intergenic
1119890577 14:78179216-78179238 CTGCCTAGATACAGGCAGGGAGG + Intergenic
1119979274 14:79061384-79061406 CTGGCTAGAGATAGGAAGGAGGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121839296 14:97119292-97119314 CTGGCTATAGTCAGTCAGAAAGG - Intergenic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124723418 15:32133373-32133395 CAAGCTATAAGCAGGCAGGAGGG + Intronic
1125534051 15:40432804-40432826 CTGGCTTCAGTCAGGCAGGATGG - Intronic
1127507381 15:59610290-59610312 CTGCTTATTCACAGGAAGGAAGG - Intronic
1129604436 15:77017979-77018001 CTGGCTTTACACAGGCACACAGG - Intronic
1129828386 15:78650706-78650728 CTTGCTGTACACCGGCAGAATGG - Intronic
1130274095 15:82467602-82467624 TTGGCCATTGACAGGCAGGATGG - Intergenic
1130466442 15:84194976-84194998 TTGGCCATTGACAGGCAGGATGG - Intergenic
1130497822 15:84478560-84478582 TTGGCCATTGACAGGCAGGATGG + Intergenic
1130588737 15:85199569-85199591 TTGGCCATTGACAGGCAGGATGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132903746 16:2271851-2271873 CAGGCTGTAGGCAGGCAGGAGGG - Intergenic
1134216648 16:12321684-12321706 CTGGGTATCCACAGGCTGGTTGG - Intronic
1134466517 16:14483651-14483673 CTGTCTAAAAACAGGCATGAGGG - Intronic
1135602128 16:23792414-23792436 CTAACCATACTCAGGCAGGAGGG - Intergenic
1137329642 16:47479589-47479611 CAGGCCATCCACAGGCAGCAAGG - Intronic
1139122965 16:64042888-64042910 CCAGCTATACCCAGGGAGGATGG + Intergenic
1139157946 16:64466949-64466971 CTGGCTAGCCATATGCAGGAAGG + Intergenic
1142590543 17:1003677-1003699 CTGCTGATACACAGGTAGGATGG - Exonic
1144016898 17:11204728-11204750 CTGGCTATCCACAGTGATGATGG - Intergenic
1144106691 17:11992536-11992558 CTGGATCTCCCCAGGCAGGATGG + Exonic
1144782911 17:17816830-17816852 GTGGCTAGGCACAGGGAGGACGG + Intronic
1147690156 17:42309902-42309924 CTGGCTATCCACAGTGAGGAAGG - Intronic
1148974489 17:51515125-51515147 CTGGCTATTCAAAGGCAGTCTGG + Intergenic
1149085530 17:52710649-52710671 CTGCCTATAGAGAGGCAGGTGGG + Intergenic
1149559097 17:57595526-57595548 CTGTCTGTACACAGGAAGGGGGG - Intronic
1151892716 17:76960161-76960183 CTGGCTCTAAAGATGCAGGAAGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1154958300 18:21281741-21281763 TTGGCTGTAAACAGGCATGAGGG + Intronic
1155734681 18:29205873-29205895 CAGGTGATACACATGCAGGATGG - Intergenic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1161776370 19:6264404-6264426 CTGCCTATCCACAGGCCTGAAGG - Intronic
1161872074 19:6878020-6878042 CTGGCTTTGCATAGGAAGGAAGG + Intergenic
1166210882 19:41305915-41305937 CTGGGAATACACACCCAGGAGGG - Intronic
1166603664 19:44120358-44120380 CTGTCTATTCACAGGCTAGAAGG + Intronic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926396244 2:12445721-12445743 CTGGCTCCACACAGACAGGGAGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
929941207 2:46335457-46335479 CTGGGTATATACAGGAAGGAGGG - Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930748827 2:54912605-54912627 TTGGGTACACACAGACAGGAAGG - Intronic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
934056257 2:88253707-88253729 GTGTCTATACACAGGATGGATGG + Intergenic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
935635239 2:105244835-105244857 CTGGGTATAAACAGGGAGGGAGG - Intergenic
936404220 2:112187875-112187897 CTGGCTACAAAAAGGCAGAAGGG - Exonic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
938888763 2:135681243-135681265 CTTGCTATACGCAGGCAGAATGG - Intronic
941094730 2:161225284-161225306 GTGGCTATTCACAGGCCTGATGG + Intronic
946352714 2:219165769-219165791 CTAACTAGACAAAGGCAGGAGGG - Intronic
947580627 2:231314859-231314881 CTGGATATTCATATGCAGGAGGG - Intronic
947857513 2:233334039-233334061 CTGGCTAGGCACAGGATGGAGGG + Intronic
948677748 2:239608983-239609005 CTGACAATACCCAGACAGGATGG - Intergenic
1168960767 20:1867869-1867891 CTGGCTATAGACAGGCTCCAGGG + Intergenic
1170407318 20:16051911-16051933 CTTGCTAGAAACAGCCAGGATGG + Exonic
1170822661 20:19767496-19767518 CTGGCTAGCCTCAGGGAGGATGG + Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1174435542 20:50503979-50504001 CTGGGTACACATAGCCAGGAAGG - Intergenic
1174591410 20:51648161-51648183 CAGGCTATACCCAGGCATGGAGG + Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175772789 20:61634247-61634269 CTGTCCACACACAGGAAGGAGGG - Intronic
1175807151 20:61835970-61835992 CTGACTACCCACAGGCTGGAGGG + Intronic
1178351556 21:31875238-31875260 GAGGCTAGAGACAGGCAGGAAGG - Intronic
1182609738 22:31537213-31537235 CTAGCTTTACACAGGAAGGTGGG + Intronic
1182735433 22:32529509-32529531 CTGGCAAAACACAGGCGGGAGGG + Intronic
1182735695 22:32531062-32531084 CTGGCAAAACCCAGGCGGGAGGG - Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949107907 3:222890-222912 CTGGCTATAAAAATGAAGGATGG - Intronic
949141783 3:642508-642530 CTGTTTATACAAAGACAGGATGG + Intergenic
950720539 3:14879443-14879465 ATGTCTATAAACAGGAAGGATGG - Intronic
952958846 3:38577198-38577220 CGGGCAACACACAGGCAGCAAGG + Intronic
953261983 3:41348481-41348503 CTGGCTTTACAGAGGAGGGATGG + Intronic
954098846 3:48354121-48354143 CTGGCCATATTCAGGGAGGAGGG + Intergenic
955041213 3:55319486-55319508 CTGGATTCAGACAGGCAGGAAGG - Intergenic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
955942226 3:64157493-64157515 CCTGCTTTACACAGGCAGCAGGG + Intronic
956758396 3:72413433-72413455 ATGGGTATTGACAGGCAGGATGG - Intronic
962410063 3:135133132-135133154 CTGACAGTACACGGGCAGGATGG - Intronic
962609625 3:137063514-137063536 CTGGCTATTTACAGCCAGCAAGG + Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
966287835 3:178318639-178318661 CTAGCTACTCACAGGCAAGAGGG - Intergenic
967521952 3:190442061-190442083 GTGGCTAGACACACACAGGAGGG - Intronic
968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG + Intronic
968893574 4:3385511-3385533 CTGGCACTGCACTGGCAGGAAGG - Intronic
975610212 4:76195793-76195815 CTGAGTATACACAGGCAGAGGGG + Exonic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG + Intergenic
980100911 4:128540359-128540381 CTGGCTTTAAAGATGCAGGAAGG - Intergenic
980244170 4:130216843-130216865 CTGGCAATGAACATGCAGGAAGG - Intergenic
984955610 4:185042771-185042793 CTCGCCATACACAGGTAAGAGGG + Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
987840244 5:23214107-23214129 CTGGCTTAACCCAGACAGGAGGG - Intergenic
988092314 5:26560001-26560023 CTGGCTTTACACAGGAAGCATGG + Intergenic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
993885841 5:93413983-93414005 CTGGCTTTAATCTGGCAGGAAGG - Intergenic
994132404 5:96245692-96245714 TTGGTTCTACACATGCAGGAAGG + Intergenic
995570123 5:113471444-113471466 CTGCCGATACCCAGGCAGAAAGG - Intronic
996063827 5:119060077-119060099 CTGACTAGACCCAGGCAGCAGGG + Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997586710 5:135047821-135047843 CTGGATATACTCAGGCTGGGAGG + Intronic
999198350 5:149798542-149798564 CTGGCTGCTCACAGGCAGCACGG - Intronic
999758811 5:154684549-154684571 CTTGCTACTCAAAGGCAGGAGGG - Intergenic
999827350 5:155286579-155286601 CTGCCTATACACAGTCAGTATGG + Intergenic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1002321226 5:178377292-178377314 CTGCCTTTGCACAGCCAGGAAGG - Intronic
1002905026 6:1441298-1441320 CTTGCTATCCACAGGGAGGTTGG + Intergenic
1002905040 6:1441396-1441418 CTTGCTATCCACAGGGAGGTTGG + Intergenic
1002905054 6:1441494-1441516 CTTGCTATCCACAGGGAGGTTGG + Intergenic
1005420031 6:25639577-25639599 TTGACTAAAAACAGGCAGGATGG - Intergenic
1005472436 6:26174488-26174510 GAAGCTATACACAGGCATGATGG - Intergenic
1006083404 6:31580385-31580407 CTGGCCATTCAGAGGCAGGGAGG + Intergenic
1006861914 6:37177416-37177438 GTGGCTATAAAGAGGAAGGAAGG + Intergenic
1008993996 6:57637094-57637116 CTGGTGATACACAGGCAGACAGG + Intronic
1010397380 6:75407716-75407738 CTCCTTATACACAGGCAGAAGGG + Intronic
1012419830 6:99052560-99052582 GTGGCAATGCACAGGAAGGAGGG + Intergenic
1014578830 6:123109059-123109081 CAGGCTATACACAGGAAGTATGG + Intergenic
1017896767 6:158686827-158686849 CTGGCCAGACACAGGTCGGAAGG + Intronic
1018028363 6:159822832-159822854 CAAGCTCCACACAGGCAGGATGG + Intergenic
1020887324 7:13834130-13834152 CTGACTATATACAGTCAGGCAGG - Intergenic
1022289704 7:28989139-28989161 CTGGCTCTACAGAGACAAGATGG + Intergenic
1022453661 7:30538333-30538355 CTGGCAATACCCAGGCAAAAAGG + Intronic
1023685511 7:42730478-42730500 TTGGCAATACACAGGCAGCAAGG - Intergenic
1023868631 7:44251154-44251176 CTGGCCAGACCCAGGCAGGGAGG - Intronic
1026539429 7:71267506-71267528 CTGAAAATACACAGGCAAGAAGG - Intronic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1028519910 7:91718284-91718306 CTAGCATCACACAGGCAGGAAGG + Intronic
1030329619 7:108257206-108257228 CTGACTATAAACAGGCAGGAGGG + Intronic
1030897992 7:115085508-115085530 CTGGATATATACAGGCATGAAGG + Intergenic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032883363 7:136114131-136114153 CTGGCAATACACAGGCAAACAGG - Intergenic
1032990559 7:137390400-137390422 ATGGCTACACATAGGCAGTACGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1037668490 8:20994352-20994374 GTGTCTATACAAAGGCATGATGG + Intergenic
1037853883 8:22355706-22355728 CTTGCTCTACACAGGCAACAAGG - Exonic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038907779 8:31926338-31926360 CTGCTTATTCACAAGCAGGATGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG + Intronic
1047219933 8:122911098-122911120 CGGTCTACACACACGCAGGATGG + Intronic
1047934615 8:129764612-129764634 CTGGCTATGCAGAGGTGGGAAGG + Intronic
1048874276 8:138824759-138824781 CTGGCTAGACACAGGAAAGTTGG - Intronic
1050074094 9:1845916-1845938 ATGGCTGTTCACAGGCAGGAAGG + Intergenic
1052056224 9:23910751-23910773 GTGGCTATTCACAAGCATGATGG - Intergenic
1055562486 9:77534846-77534868 TTGGCTGTAGACAGTCAGGATGG + Intronic
1056417496 9:86390796-86390818 CTGGCTATACCCAGGCAAACAGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1185686636 X:1934173-1934195 CTGAGGATACACAGGCACGATGG - Intergenic
1189082351 X:37988208-37988230 CTGGCTGTAAATAGGAAGGAAGG + Intronic
1189249485 X:39589000-39589022 CTGATTATACACAGCAAGGAGGG + Intergenic
1191848704 X:65569769-65569791 ATGGCTAGACTCAGGCAAGATGG - Intergenic
1192370149 X:70506446-70506468 CTGGCCATAGGCAGACAGGAAGG - Intergenic
1193228338 X:79012697-79012719 CTGGTGATACACAGGCAGACAGG - Intergenic
1194880216 X:99241892-99241914 TTGAATATACACAGTCAGGATGG + Intergenic