ID: 904618453

View in Genome Browser
Species Human (GRCh38)
Location 1:31762332-31762354
Sequence AGTATCCTCTGCACTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904618453_904618461 11 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618461 1:31762366-31762388 TGCTCTGTCCCAGGGTCAGGTGG 0: 2
1: 1
2: 9
3: 212
4: 485
904618453_904618460 8 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618460 1:31762363-31762385 GCTTGCTCTGTCCCAGGGTCAGG 0: 1
1: 0
2: 1
3: 31
4: 470
904618453_904618459 3 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618459 1:31762358-31762380 CAGGTGCTTGCTCTGTCCCAGGG 0: 1
1: 0
2: 2
3: 60
4: 958
904618453_904618458 2 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618458 1:31762357-31762379 CCAGGTGCTTGCTCTGTCCCAGG 0: 1
1: 0
2: 4
3: 59
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904618453 Original CRISPR AGTATCCTCTGCACTGCTAC TGG (reversed) Intronic
900366131 1:2312688-2312710 CGTAGCCTCTGCACAGCTGCTGG + Intergenic
902603192 1:17554027-17554049 CGTATCCTCTGCACTTCCTCTGG - Intronic
904618453 1:31762332-31762354 AGTATCCTCTGCACTGCTACTGG - Intronic
905236435 1:36553314-36553336 AGTGTCCTGTGCACTACGACAGG - Intergenic
908717487 1:67086037-67086059 AGAATCATTTGCACTGCTATTGG - Intergenic
912461179 1:109832599-109832621 AGTATCCTAGGCACTGCCAATGG + Intergenic
915915516 1:159938164-159938186 AGTCTCCTCTGGACTCTTACAGG + Intronic
918632931 1:186740406-186740428 AGTGGTCTCTGCACTGCTCCTGG - Intergenic
918806323 1:189050700-189050722 AGTATCTTCTGCATTTCTATGGG + Intergenic
921725526 1:218519278-218519300 TGTCTCCTCTGCACTGCCATAGG - Intergenic
921891729 1:220360545-220360567 AGCATCTTCTGCATTGCTTCTGG + Intergenic
1063959284 10:11293490-11293512 AGGAACCTCTGCACTGCCCCAGG - Intronic
1066560387 10:36663599-36663621 AGTTTCTTCTGCACAGCTAAAGG + Intergenic
1070550735 10:77488767-77488789 AGTGTCCTCTGCACTTCTACTGG - Intronic
1071100972 10:82037287-82037309 AGGATCCTCTGTACTTTTACTGG + Intronic
1074458086 10:113612902-113612924 AGCATCCTCCCCACTGCTCCTGG - Intronic
1076477346 10:130761936-130761958 TGTGTCCTCTGCACGCCTACAGG - Intergenic
1079586119 11:22128477-22128499 ACTATACTCTGCAGAGCTACAGG - Intergenic
1084272739 11:68037933-68037955 AGTATTCAGTGCACAGCTACAGG - Intergenic
1086454588 11:86948534-86948556 AGTAGCCTTAGCAATGCTACAGG - Exonic
1087368155 11:97248176-97248198 AAAATCCACTGCTCTGCTACTGG - Intergenic
1087389477 11:97515364-97515386 AGTATTCTCTGCAATCCCACTGG - Intergenic
1087809007 11:102590144-102590166 TGTAGCCACTGCTCTGCTACTGG + Intronic
1088118832 11:106343716-106343738 AATCTCCTCTGCCCTGCTGCTGG + Intergenic
1089503324 11:118946003-118946025 AGTTACCTCTGCACTCTTACAGG + Intronic
1090473673 11:127001357-127001379 AGTTTGCTTTGCACTGCTCCTGG + Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1102642144 12:114376446-114376468 ATTCTCCTCTCCACTGCTACAGG - Intronic
1104775721 12:131389176-131389198 TGTAGCCTCTGCTCTGCTGCGGG - Intergenic
1105249144 13:18680748-18680770 AGTAGCCTCTGCGCTGTTGCGGG - Intergenic
1105713580 13:23037828-23037850 AGTATCCCCTGAAATGCTAATGG - Intergenic
1105989317 13:25602686-25602708 ACAATGCTCTACACTGCTACAGG - Intronic
1108033895 13:46266944-46266966 AGTAACTTCTGAACTTCTACTGG - Exonic
1114020842 14:18477228-18477250 AGATTCCACAGCACTGCTACTGG - Intergenic
1114495487 14:23128733-23128755 AGTATCCTCTTCAGGGCTCCAGG + Intronic
1118788069 14:69063333-69063355 AGTTTCCACTGCACTGGTAATGG + Intronic
1127552530 15:60055067-60055089 AGTATGTTTTGCACTTCTACAGG + Intronic
1131366283 15:91844760-91844782 AGTTTCCCCTGCACTGTTTCAGG - Intergenic
1137599046 16:49743788-49743810 TGGAGCCTCTGCACTGCGACTGG - Intronic
1138633773 16:58320285-58320307 TCTATCCTCTGCACTGGAACAGG + Intronic
1140681014 16:77384664-77384686 AGTACAATCTTCACTGCTACAGG - Intronic
1141890135 16:86920762-86920784 AGAATCTTCTGCACTCCTTCTGG - Intergenic
1146794336 17:35770469-35770491 AGTAGGCTCTGCACTACTTCAGG + Intronic
1148123445 17:45225150-45225172 AAATTCCTCTCCACTGCTACTGG - Intronic
1149460179 17:56822804-56822826 CATATCCTCAGCACTTCTACAGG + Intronic
1152526579 17:80891465-80891487 AGAATCCTCCCCACTGCTAGAGG - Intronic
1156844843 18:41653215-41653237 TGTAACCTTTGCTCTGCTACTGG + Intergenic
931138877 2:59435363-59435385 GGTATTCTCTTCACTGCTGCAGG + Intergenic
935318884 2:101865833-101865855 AGAATCCTCAGCACTGCTAATGG + Intronic
939651378 2:144766897-144766919 ACTATCCTCTGCACAGGTAGGGG + Intergenic
947669504 2:231927311-231927333 AGTATCCTGTGCACTTTCACAGG + Intergenic
1169442560 20:5644803-5644825 AGTGTCCTCTAAACTGCTACAGG + Intergenic
1172319230 20:33983232-33983254 AGTATCCTCTCCCCTTGTACTGG - Intergenic
1175102875 20:56592391-56592413 AGTATCCTCTGCACACCTGCTGG - Intergenic
1178240101 21:30889439-30889461 AGTGTTCTCAGCATTGCTACTGG - Intergenic
1180445330 22:15407814-15407836 AGATTCCACAGCACTGCTACTGG - Intergenic
1183268459 22:36845875-36845897 TGTATGCTCAGCACTGCTCCAGG - Intergenic
1184712200 22:46258302-46258324 TGTATCCTCTGCATTTCTTCTGG + Exonic
950946934 3:16959028-16959050 GGCATCCTTTGCTCTGCTACTGG - Intronic
951622613 3:24621923-24621945 AGTTTTCTCTGCACTGATAATGG + Intergenic
952053074 3:29409892-29409914 AGTATACTGTGCACTGTTATGGG + Intronic
952079068 3:29735358-29735380 AGTATCCTCTCCATTGTTAATGG - Intronic
957119092 3:76065897-76065919 ATTATCATCTGCACTGCCATGGG - Intronic
962023111 3:131520676-131520698 AGCATTCTCTGCAATGCTCCTGG - Intergenic
962289638 3:134123244-134123266 AATATCCACTGCCCTGCTGCAGG - Intronic
973197046 4:47456597-47456619 TATTTCCTCTGCACAGCTACAGG - Exonic
980806158 4:137816844-137816866 ATGATACTCTTCACTGCTACAGG - Intergenic
984171383 4:176363505-176363527 AGTATCTTCTGCCCTTCTGCAGG + Intergenic
992546115 5:77815600-77815622 AGTAATCTCTTCACTTCTACTGG + Intronic
995260218 5:110095356-110095378 TGTATCCTTTGCTGTGCTACAGG + Intergenic
995369746 5:111405780-111405802 AATATCCTCTCCACTGCTTTCGG - Intronic
997836508 5:137197922-137197944 ATCATCCTCCTCACTGCTACTGG + Intronic
1000447588 5:161343006-161343028 TGTATGCTCTGCACAGGTACAGG + Intronic
1008468498 6:51856826-51856848 GGTATCCTCTGCCCTGGCACAGG + Intronic
1021481462 7:21122324-21122346 ACAATCCTCTTCACTGCTCCAGG + Intergenic
1022785224 7:33631645-33631667 AGGGGCCCCTGCACTGCTACTGG - Intergenic
1024872683 7:53984235-53984257 AATATCCTCTGTCCTGCTTCAGG - Intergenic
1024960547 7:54970239-54970261 AATATCTTCTTCACTACTACAGG - Intergenic
1031303110 7:120089081-120089103 ATAATACTCTGGACTGCTACTGG - Intergenic
1039086619 8:33786677-33786699 ACTGTCCTCTGCAATGCAACAGG - Intergenic
1040545464 8:48395398-48395420 AGGCTCCCCTGCACTGCTGCTGG + Intergenic
1041296566 8:56362934-56362956 AGTATCCACTGCCCTGCCACAGG - Intergenic
1042678193 8:71347138-71347160 AGTGACCTAAGCACTGCTACTGG + Intronic
1048538794 8:135323503-135323525 AGTGTCCTCTGCCCTGGTCCTGG - Intergenic
1048962711 8:139593820-139593842 AGTGTCCTCTGCCCAGCTACTGG + Intergenic
1055633694 9:78252254-78252276 AGTTTCCTCTGGACTCCCACAGG - Intronic
1055664928 9:78543882-78543904 AGTCTCCCCTGCGCTGCCACAGG - Intergenic
1057967199 9:99515805-99515827 AGTATCATCCGCCATGCTACAGG + Intergenic
1059976754 9:119725778-119725800 AGTCTCCTCTCCTATGCTACTGG - Intergenic
1062091995 9:134683195-134683217 TGTAGCCTCAGCACTGCCACGGG - Intronic
1196661831 X:118278620-118278642 AATATCATCTTCACTGCTCCTGG - Intergenic
1201324407 Y:12739925-12739947 ATTATTCTCTGCATTTCTACAGG - Intronic
1201345933 Y:12984752-12984774 AATATCCCCAGCACTGGTACAGG - Intergenic