ID: 904618453

View in Genome Browser
Species Human (GRCh38)
Location 1:31762332-31762354
Sequence AGTATCCTCTGCACTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904618453_904618461 11 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618461 1:31762366-31762388 TGCTCTGTCCCAGGGTCAGGTGG 0: 2
1: 1
2: 9
3: 212
4: 485
904618453_904618459 3 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618459 1:31762358-31762380 CAGGTGCTTGCTCTGTCCCAGGG 0: 1
1: 0
2: 2
3: 60
4: 958
904618453_904618460 8 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618460 1:31762363-31762385 GCTTGCTCTGTCCCAGGGTCAGG 0: 1
1: 0
2: 1
3: 31
4: 470
904618453_904618458 2 Left 904618453 1:31762332-31762354 CCAGTAGCAGTGCAGAGGATACT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 904618458 1:31762357-31762379 CCAGGTGCTTGCTCTGTCCCAGG 0: 1
1: 0
2: 4
3: 59
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904618453 Original CRISPR AGTATCCTCTGCACTGCTAC TGG (reversed) Intronic