ID: 904618873

View in Genome Browser
Species Human (GRCh38)
Location 1:31763891-31763913
Sequence GCCCCCGCTCCTGCTGCTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 350}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904618873_904618877 -10 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618877 1:31763904-31763926 GAGCGGGGGCCGGCGCTGGCGGG 0: 1
1: 0
2: 5
3: 67
4: 657
904618873_904618879 -8 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618879 1:31763906-31763928 GCGGGGGCCGGCGCTGGCGGGGG 0: 1
1: 1
2: 10
3: 126
4: 1167
904618873_904618888 30 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618888 1:31763944-31763966 AGTTTGCCATCCCTAAGTCGGGG 0: 1
1: 0
2: 1
3: 2
4: 54
904618873_904618882 1 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618882 1:31763915-31763937 GGCGCTGGCGGGGGCGGCCACGG 0: 1
1: 2
2: 4
3: 79
4: 833
904618873_904618884 3 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618884 1:31763917-31763939 CGCTGGCGGGGGCGGCCACGGGG 0: 1
1: 0
2: 2
3: 26
4: 331
904618873_904618886 28 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618886 1:31763942-31763964 CAAGTTTGCCATCCCTAAGTCGG 0: 1
1: 0
2: 1
3: 5
4: 80
904618873_904618880 -5 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618880 1:31763909-31763931 GGGGCCGGCGCTGGCGGGGGCGG 0: 1
1: 1
2: 15
3: 207
4: 1771
904618873_904618883 2 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618883 1:31763916-31763938 GCGCTGGCGGGGGCGGCCACGGG 0: 1
1: 1
2: 2
3: 22
4: 382
904618873_904618878 -9 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618878 1:31763905-31763927 AGCGGGGGCCGGCGCTGGCGGGG 0: 1
1: 0
2: 5
3: 39
4: 454
904618873_904618887 29 Left 904618873 1:31763891-31763913 CCGTCAGCAGCAGGAGCGGGGGC 0: 1
1: 0
2: 2
3: 46
4: 350
Right 904618887 1:31763943-31763965 AAGTTTGCCATCCCTAAGTCGGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904618873 Original CRISPR GCCCCCGCTCCTGCTGCTGA CGG (reversed) Exonic
900237555 1:1599985-1600007 CCCGCCGCTGCTGCTGCTGCTGG - Exonic
900292734 1:1930385-1930407 GCCCCCGCGCCTGCCGCAGAGGG - Intronic
900320171 1:2079638-2079660 GGCCCCGCGGCTGCTGCTGATGG + Intronic
900379503 1:2376933-2376955 GCTCCTGATCCTCCTGCTGACGG + Intronic
900581469 1:3411879-3411901 GCCCTGGCTGCTGTTGCTGACGG - Exonic
900618472 1:3576224-3576246 GCTCCCGCTGCTTCTGCGGAAGG + Intronic
901098455 1:6701504-6701526 GCCTCCGCCCCAGCTCCTGAAGG - Intronic
901473475 1:9473411-9473433 CCCCCAGCTCCTGCCGCTGCTGG - Intergenic
902167389 1:14583633-14583655 GCCCCTGCTCTTGCAGCAGAGGG + Intergenic
902359774 1:15936012-15936034 GCCCCTGCTCCTGCCCCTCATGG + Exonic
902394061 1:16122807-16122829 GCCCTGGCCCCTGCTGCTGCAGG - Intergenic
902518397 1:17002127-17002149 GCCACAGCTCCTCCTTCTGATGG - Intronic
902629878 1:17698416-17698438 GGCTCTGCTCCTGCAGCTGATGG - Intergenic
902637348 1:17743327-17743349 GCTCCTGCTCCTGCTCCTGCTGG + Intergenic
903286900 1:22282986-22283008 GCCCATGCTCCTGCTTCTGATGG + Intergenic
904618873 1:31763891-31763913 GCCCCCGCTCCTGCTGCTGACGG - Exonic
905536710 1:38728264-38728286 TCCCACGTCCCTGCTGCTGATGG - Intergenic
907786826 1:57620693-57620715 TCCCCTACTCCTGCTGCTGCTGG - Intronic
909965112 1:81899935-81899957 GTCCCCAAACCTGCTGCTGATGG + Intronic
910145732 1:84078112-84078134 GCCGCCGCCGCTGCTGCTGCCGG + Intronic
912905263 1:113699110-113699132 GCCCAGGAACCTGCTGCTGATGG - Intronic
912950737 1:114118618-114118640 GCTCCTGCTGCTGCTGCAGAGGG + Intronic
914932908 1:151950505-151950527 GCCTCCTCTCCTGCTGCTGGAGG + Intergenic
915034452 1:152910502-152910524 GCTGCCCCTCCTGCTGCTGTGGG - Exonic
915606850 1:156957588-156957610 GCCCACGCCCCTGATGCTCAGGG - Intronic
919745972 1:201009397-201009419 GCCCCAGGTCCTGCTGGGGAAGG - Exonic
921264707 1:213412545-213412567 GCCCCCACTACAGCTTCTGAAGG - Intergenic
922321967 1:224496410-224496432 ACCATCGCTCCTGCTGCTGCTGG + Intronic
922925393 1:229343033-229343055 GCCCGCGCTCCAGCTGCAGGCGG + Intronic
924802114 1:247335244-247335266 GCCCCAGCTCCTGCTACATACGG - Intergenic
1062799478 10:368694-368716 CGCCCTGCACCTGCTGCTGAAGG + Intronic
1063882341 10:10543799-10543821 GCCCCCTCTCCCGCTTCAGAGGG + Intergenic
1067432552 10:46253512-46253534 TCGTCCCCTCCTGCTGCTGAAGG - Intergenic
1067755041 10:48998978-48999000 GCCCCTGCCCCAGCTGCTGGGGG - Intergenic
1067828574 10:49597029-49597051 CCTCCTGCTCCTGCTGCTGTGGG + Intergenic
1067945584 10:50686264-50686286 GCCCGCGCTCTTCCTGATGAGGG - Intergenic
1069809965 10:71151242-71151264 GCCCCAGCTACTTCTGCAGAGGG - Intergenic
1070351163 10:75593437-75593459 GCTGCCACTGCTGCTGCTGATGG + Intronic
1070828956 10:79407095-79407117 GCCCCCTCTACACCTGCTGAAGG + Intronic
1070867095 10:79713137-79713159 GCCCGCGCTCTTCCTGATGAGGG - Intronic
1070880885 10:79851258-79851280 GCCCGCGCTCTTCCTGATGAGGG - Intergenic
1071634010 10:87235361-87235383 GCCCGCGCTCTTCCTGATGAGGG - Intronic
1071647456 10:87367578-87367600 GCCCGCGCTCTTCCTGATGAGGG - Intronic
1072757189 10:98029477-98029499 GCCGCCGCTGCTGCTGCTGGTGG - Intronic
1072757191 10:98029480-98029502 GCCGCCGCCGCTGCTGCTGCTGG - Intronic
1073288054 10:102400182-102400204 GCCCCCGCACCTGGTGCAGGTGG - Exonic
1074064927 10:110006014-110006036 GCCGCTGCTGCTGCTGCTGTTGG + Intronic
1074960333 10:118439238-118439260 GCCTCCCCTCCTGCAGCTCAAGG - Intergenic
1075952871 10:126497177-126497199 GCACCTGTTCTTGCTGCTGATGG + Intronic
1076210048 10:128632869-128632891 GCCCCTGCACATGCTGCTGATGG - Intergenic
1076235438 10:128860725-128860747 GCACCAGCTCCTGCTGCTGAGGG + Intergenic
1076312020 10:129515265-129515287 GCCGCAGCTGCTGCTCCTGACGG - Intronic
1076611831 10:131730878-131730900 GCCCTGCCTCATGCTGCTGAAGG - Intergenic
1076741563 10:132488267-132488289 GTCCCAGCTCCTGCTGCTCCAGG - Intergenic
1077168859 11:1157587-1157609 GCCCCCTGTCCTGCTGCAGAGGG + Intergenic
1077350268 11:2090015-2090037 ACCCCCGATGCTGCTGCTCAGGG + Intergenic
1077484971 11:2834474-2834496 GCCTCTGCTCCTGCCTCTGAGGG + Intronic
1077524034 11:3053627-3053649 CCCCCAGGTTCTGCTGCTGAAGG - Intronic
1077919130 11:6630254-6630276 TCCCGCGCTGCTGCTGCTGGTGG - Exonic
1078105320 11:8354727-8354749 GCCCCAGCTGCTGCTCCTCAGGG - Intergenic
1078190799 11:9091441-9091463 GCCGCCACTGCTGCTGCTGGCGG - Exonic
1081794621 11:45810969-45810991 GCCCCTGCTCCTGCTGCTCGGGG + Exonic
1081905552 11:46667292-46667314 GCCCCCACTGCTGCTGCTTAGGG + Intronic
1081968673 11:47184561-47184583 GCGCCCGCTCCAGCAGCTGTGGG + Intronic
1083180944 11:60984801-60984823 GCCCCTGCTCCTCCCCCTGACGG - Intronic
1083255316 11:61491818-61491840 GCCCCCAGGCCTGCTGCTCAAGG - Intergenic
1084001203 11:66296199-66296221 GCCCTCTCTCCCGCTGCTCAGGG + Exonic
1084150492 11:67285857-67285879 GCACCCCCTCCTGCTGCAGAGGG + Exonic
1084793352 11:71489001-71489023 CCCACCCCTCCTGCTGCTGTGGG - Intronic
1085011165 11:73142426-73142448 CGCCCCGCTCCGGATGCTGAGGG + Intergenic
1085258651 11:75191636-75191658 GGCCCTGGTCCTGCTGCTGCAGG + Intronic
1085402993 11:76245698-76245720 GCTCCCTCTCCTCCTGCTGTTGG - Intergenic
1085529249 11:77181944-77181966 GCCCTCGCTCCAGGTCCTGAAGG - Exonic
1085724391 11:78941619-78941641 GCCCCAGCACCTGCTGCTTGTGG - Intronic
1086900066 11:92357244-92357266 GCCCCAGCTCATGGTGCTGTTGG - Intronic
1088626781 11:111735444-111735466 GCCCCCGCTGAAGCTGCTGACGG - Intronic
1088709982 11:112499265-112499287 ACCTCCCCTCCTGCCGCTGAAGG - Intergenic
1088840643 11:113624755-113624777 GCCCCAGCTCCTGCTCTAGAGGG + Intergenic
1089273229 11:117315759-117315781 GCCCTGGCTCCTGCTGTGGATGG - Exonic
1089517709 11:119044437-119044459 GCCCTAGCTCCTGCTACAGACGG + Exonic
1090306722 11:125697736-125697758 GCTCATGCTCCTGCTGCTGGGGG + Intergenic
1090788479 11:130070019-130070041 GCTCCTGCTTCTGCTGCTGGTGG + Exonic
1091865684 12:3834199-3834221 GCCACTGCTCCTGGGGCTGAAGG - Intronic
1092053978 12:5493772-5493794 GCCACCGCTGCTGCTGCTGAAGG + Intronic
1092791355 12:12073266-12073288 GCCCCCGCTCCCTCCGCTGTAGG + Intronic
1093465041 12:19440130-19440152 ATCCCCGCTGCTGCTGCTGGCGG - Exonic
1096685428 12:53285395-53285417 GCCCCCACACCTGCAGCTCAGGG - Intronic
1096914516 12:55017295-55017317 GCCACGGATCCTGTTGCTGATGG - Intergenic
1097056927 12:56255972-56255994 GCCCCAGCACCTTCTGTTGAGGG + Exonic
1100984228 12:100189416-100189438 GCTCCTGCTCCTGCTGCTTGGGG - Intergenic
1103572538 12:121854664-121854686 GCCCCCACCCCTCCTGCTGTCGG - Intronic
1104841620 12:131828560-131828582 GCTGCCGCTGCTGCTGCTGCTGG + Exonic
1104975899 12:132551892-132551914 GGCCTCGCTCCTCCTGCTGCCGG + Intronic
1105009382 12:132745250-132745272 GCCCAGGCTACTGCTGTTGAGGG + Intronic
1105502877 13:20988332-20988354 GCCCCCGCCCCGGCTGCGGAGGG - Exonic
1105893115 13:24696267-24696289 GCTCCAAGTCCTGCTGCTGATGG - Intronic
1106720153 13:32428013-32428035 GCTGCCGCTGCTGCTGCTGCTGG + Exonic
1106793882 13:33184361-33184383 GCTGCTGCTGCTGCTGCTGATGG + Intronic
1107548901 13:41457497-41457519 GCCTCCGCTCCGGCCGCCGAAGG + Intergenic
1107986935 13:45783904-45783926 GCCCCGCCTCCTGGTGGTGAAGG + Exonic
1108025966 13:46177853-46177875 GCTGCTGCTGCTGCTGCTGATGG + Intronic
1108578782 13:51811292-51811314 GCGCCAGCACCTGCTGCTGGGGG + Intergenic
1112630486 13:101156397-101156419 TTCCCCGCTCTTTCTGCTGAGGG - Intronic
1113705725 13:112431858-112431880 GCCCCAGCTTCTGCAGCTGTTGG - Intronic
1113801574 13:113089275-113089297 GCCCACCCTCCTGCTTCTGAGGG - Intronic
1113801588 13:113089345-113089367 GCCCACCCTCCTGCTTCTGAGGG - Intronic
1113801603 13:113089415-113089437 GCCCACCCTCCTGCTTCTGAGGG - Intronic
1114057407 14:18984244-18984266 GCTCCCGCTCTTGCTGCTGCCGG + Intronic
1114105139 14:19417503-19417525 GCTCCCGCTCTTGCTGCTGCCGG - Intronic
1116895680 14:50312635-50312657 GCCCCCGCTCCAGCTCCAGCCGG + Exonic
1120341452 14:83225791-83225813 GCACCCGCTGCTGCTCCTGATGG + Intergenic
1121091455 14:91185554-91185576 GCCACCGCTCCTGGTGCTCTGGG + Intronic
1121775145 14:96585331-96585353 GCCCCCACTCCTGCAGCCGCTGG - Intergenic
1122203578 14:100137194-100137216 GGCCCGGCACCTGCTACTGAGGG - Intronic
1122227235 14:100286847-100286869 GCCCCAGCTGATCCTGCTGAAGG + Intergenic
1122578561 14:102756936-102756958 GCCTTCCCTGCTGCTGCTGATGG - Intergenic
1123043012 14:105498165-105498187 GCCCCCGCCCCTCCTGCGGGAGG + Intronic
1123505790 15:20940899-20940921 CCCCCCCCACCCGCTGCTGAGGG - Intergenic
1123563025 15:21514605-21514627 CCCCCCCCACCCGCTGCTGAGGG - Intergenic
1123599272 15:21951888-21951910 CCCCCCCCACCCGCTGCTGAGGG - Intergenic
1127676638 15:61245667-61245689 GTCCCAGGTGCTGCTGCTGATGG + Intergenic
1128659075 15:69484700-69484722 GCTCCAGCACCTCCTGCTGATGG - Intergenic
1129155830 15:73717016-73717038 GCCCAGGCTCCTGCTGCCCAGGG - Intergenic
1129672172 15:77613448-77613470 GCCCCCTAGCCTGCTCCTGATGG + Exonic
1130127783 15:81108477-81108499 GCCCCTGCTCTTCCTCCTGAGGG + Intronic
1132392304 15:101447854-101447876 GCCACCGCTCCTGATTCTAAAGG - Intronic
1132404873 15:101536157-101536179 GCCCCAGATCCTGCTTCTGGAGG - Intergenic
1202971376 15_KI270727v1_random:241740-241762 CCCCCCCCACCCGCTGCTGAGGG - Intergenic
1132598075 16:762238-762260 GCCCAGGCACCTGCAGCTGAGGG + Intronic
1132602878 16:781775-781797 GACCCCCGTCCTGCTGCTGCTGG + Intronic
1132892369 16:2210584-2210606 GCTCCTGCTGCTGCTGCTGCTGG - Exonic
1133138526 16:3728788-3728810 GCACCTGCTGTTGCTGCTGAGGG + Exonic
1133978389 16:10616748-10616770 GGACTCGCTCCTGCTGCTGCGGG - Intergenic
1135087517 16:19487145-19487167 GCCGCTGCTCCGGCTGCAGATGG + Intronic
1135413151 16:22250195-22250217 GCCGCTGCTCCTGGTGCTGCAGG + Intronic
1136032165 16:27511271-27511293 GCCCCCTCTTCTGCTGCTCTTGG + Intronic
1136091121 16:27920757-27920779 GCCACTTCTCCTGCTGGTGAGGG + Intronic
1136356405 16:29747079-29747101 TCCCTCTTTCCTGCTGCTGAGGG + Intergenic
1137668620 16:50266497-50266519 GCCGCCGCTGCTGCCGCTGCCGG + Exonic
1139488168 16:67271096-67271118 GCTGCAGCTCCTGCTGCTGGGGG - Exonic
1139582102 16:67879863-67879885 GCTACCGCTGCTGCTGCTGCTGG - Exonic
1139583127 16:67884917-67884939 GCCGCCGCCGCTGCTGCTGCCGG + Exonic
1139740924 16:69034276-69034298 GCCCAAGATGCTGCTGCTGATGG + Intronic
1139796529 16:69487076-69487098 GCCTCCGTTCCTGTTGATGAAGG - Intergenic
1141495773 16:84408413-84408435 CCCCCTGATCCTGCTGCTGCTGG + Exonic
1141608721 16:85169716-85169738 GCGCCGGCTCCTGCTGCTGCAGG - Intergenic
1141886220 16:86894268-86894290 GCCCTGGCTGCTGCTGCTGCCGG - Intergenic
1141993979 16:87625506-87625528 GGCCCTGCTCCTCCTGCTCAGGG - Intronic
1142289092 16:89184506-89184528 GCCCCCGCCCCACCTGCTGTGGG - Intronic
1142795400 17:2303502-2303524 GCCCCAGCGCCTACTGCTGGGGG + Intronic
1144384478 17:14736694-14736716 GCCACCGCTGCTTCTGCTGGAGG + Intergenic
1144500947 17:15786462-15786484 GGCCCGGCGCCTGCGGCTGACGG + Intergenic
1145163107 17:20589124-20589146 GGCCCGGCGCCTGCCGCTGACGG + Intergenic
1146022930 17:29293972-29293994 GCTGCTGCTGCTGCTGCTGAGGG + Exonic
1146260374 17:31416670-31416692 GCCCCTTCTCCTGCTGCTGCAGG - Intronic
1146264767 17:31445116-31445138 GCCCAAGCTCCTGCTGCAGATGG + Intronic
1146889034 17:36493028-36493050 GGCCCCACTCCTGATGCTCAAGG - Intronic
1147187941 17:38722702-38722724 GCTGCTGCTCTTGCTGCTGAAGG - Exonic
1147818615 17:43228461-43228483 GCTGCAGCTCCTGCTGCTGCTGG + Intergenic
1147831898 17:43303163-43303185 GCTGCAGCTCCTGCTGCTGCTGG + Intergenic
1148465975 17:47865525-47865547 GCACCTGTTCCTGCTGTTGAGGG + Intergenic
1148894794 17:50833439-50833461 ACCCCCACTCCTGGGGCTGATGG - Intergenic
1150134409 17:62688192-62688214 CCCCCAGGACCTGCTGCTGAGGG + Intronic
1151712245 17:75813439-75813461 TCCACCGCTCCTGATCCTGAGGG + Intronic
1151907161 17:77056179-77056201 GCCCCGGCTTGGGCTGCTGAGGG - Intergenic
1151957167 17:77386229-77386251 GCCCCCACCCCTCCTGCAGAGGG + Intronic
1152246342 17:79186606-79186628 GCCCCCGCTCCTGGGGCGGAGGG + Intronic
1152406747 17:80102161-80102183 GCCACCTCTCCTGCTCCTGCAGG + Intergenic
1152735940 17:81996786-81996808 GCTCCTGCTCCTGCTCCTGCTGG - Exonic
1152735951 17:81996822-81996844 GCTCCCGCTCCTGCTCCTGCTGG - Exonic
1152863568 17:82709534-82709556 GCTACAGCTCCGGCTGCTGAGGG - Intergenic
1155191936 18:23437919-23437941 GCTGCCGCTGCTGCTGCTGCGGG - Intronic
1157204646 18:45687823-45687845 GCCCCCACACCTTCTACTGATGG - Intergenic
1157327563 18:46680039-46680061 GCACCTGCAGCTGCTGCTGATGG - Exonic
1157475360 18:48020587-48020609 ACCCCAGATCCTGCTCCTGAGGG - Intergenic
1157513612 18:48295815-48295837 TGCCCCCCTCCTGCTGCTGCTGG - Intronic
1157599842 18:48887200-48887222 GCCCCTGCATCTGCTGCTGCTGG + Intergenic
1158023599 18:52870375-52870397 GCCATCGCTCCAGCTGCTGTGGG - Intronic
1158699224 18:59731577-59731599 GCCCCTGAGCCTGCTGATGATGG + Intergenic
1159402919 18:67960335-67960357 GCTGCTGCTGCTGCTGCTGATGG + Intergenic
1160476144 18:79190038-79190060 GCCCCTCCTGCTGCTGCTGCGGG - Intronic
1160715738 19:575819-575841 GTCCCTCCTCCTGCTGCTCATGG + Intronic
1160799761 19:962334-962356 GGTCCAGCTGCTGCTGCTGAGGG - Intronic
1160908949 19:1466028-1466050 GCACCCGCTGCTGCGGCTCAAGG + Exonic
1161077237 19:2291725-2291747 GCCCCTGCTCCTGCTGCCCGCGG - Exonic
1161084905 19:2330485-2330507 GCCCCCGCTTATGCTGCTTCTGG - Intronic
1161210295 19:3062242-3062264 GCCCCGGCTCGGGCTGCTGGGGG + Intronic
1161235016 19:3193407-3193429 GGCTCCGCCTCTGCTGCTGAAGG + Exonic
1161297470 19:3527106-3527128 GACCCACCTCTTGCTGCTGACGG - Intronic
1161607074 19:5221048-5221070 GCCCCCAAGCCTGATGCTGACGG - Exonic
1162019859 19:7863417-7863439 GCCCCAGGTGCGGCTGCTGAAGG + Exonic
1162495620 19:11021817-11021839 ACCCCGCCGCCTGCTGCTGACGG + Exonic
1162578576 19:11513834-11513856 TCCCACACTCCTGCTGCCGAGGG + Exonic
1163118277 19:15200803-15200825 GCCCCTGCTGCTGCTGCTAGCGG - Exonic
1163213949 19:15862597-15862619 CCCCCCGATTCTGCAGCTGAGGG + Intergenic
1163267951 19:16232936-16232958 GCCCTGGGTCCTGCTCCTGAGGG - Intronic
1163390263 19:17026588-17026610 GCTCCTGCTCCTGCTGCTGTCGG - Exonic
1163560118 19:18014126-18014148 GCCCCCGATCTGGCTGCTGAGGG + Intergenic
1163587917 19:18173871-18173893 GCCACCGCTGCTGCTGCTGCTGG + Exonic
1164464607 19:28476701-28476723 GCCCCTGCTCATCCTCCTGAGGG + Intergenic
1164509955 19:28888969-28888991 GCTCCAGCTCCGGCTGCAGATGG + Intergenic
1164721536 19:30435609-30435631 GCTCTTGCTGCTGCTGCTGAGGG + Intronic
1164995835 19:32720075-32720097 GCTCCAGCTCCTGGTGCTGAAGG + Exonic
1164999382 19:32748583-32748605 GCCTCAGCTTCTGCTGCTGGCGG + Intronic
1165489579 19:36115477-36115499 GCCGCCGCCGCTGCTGCTGCTGG - Exonic
1167103801 19:47419228-47419250 GGCCCGGCGCCTGCCGCTGACGG - Exonic
1167660004 19:50790782-50790804 GGCCCAGCTCCAGCTGCTGGCGG - Exonic
1168048520 19:53811166-53811188 CACCCGGCTCCTGCTGGTGAAGG - Exonic
1168295784 19:55376880-55376902 GGGCCTGCTCCTGCTGCTGCAGG + Exonic
925130984 2:1493868-1493890 GGCCACGCTCCTGCTGGCGATGG - Exonic
925194181 2:1910129-1910151 GTCCCTGCCCCTGCTGCTGTAGG + Intronic
925556296 2:5134625-5134647 GCTGCCCCTCCTCCTGCTGAGGG - Intergenic
928322395 2:30294339-30294361 GCTGCCGCTGCTGCTGCTGCTGG - Intronic
929081760 2:38128528-38128550 TGCCCCTCTCCTGCTGCTAATGG + Intergenic
933762117 2:85679529-85679551 GCCCACGCACCTGCTGAGGAAGG + Intergenic
933945311 2:87281150-87281172 GACCCCGCTGCTCCTGCTGCTGG - Intergenic
933973511 2:87489454-87489476 GCCCCAGCTCCTGCCTCTGTTGG - Intergenic
934567881 2:95350592-95350614 GCCCCCACCCCTGCTGCTCCGGG - Intronic
935203206 2:100876339-100876361 GTCCCCACGCCTGCTGCTCAGGG + Intronic
936151013 2:110022551-110022573 GGCCCTGCTGCTGCTTCTGAAGG + Intergenic
936161787 2:110088954-110088976 GCCCCAGCTCCAGCAGCTGGGGG + Intronic
936182876 2:110282400-110282422 GCCCCAGCTCCAGCAGCTGGGGG - Intergenic
936193664 2:110348818-110348840 GGCCCTGCTGCTGCTTCTGAAGG - Intergenic
936320214 2:111460759-111460781 GCCCCAGCTCCTGCCTCTGTTGG + Intergenic
936334896 2:111580441-111580463 GACCCCGCTGCTCCTGCTGCTGG + Intergenic
936370525 2:111898744-111898766 GGCCCCGCTGCCGCTGCTGCTGG + Exonic
938082966 2:128380070-128380092 GACCCGCCTCCTGCTGCTGGGGG + Intergenic
938093726 2:128448724-128448746 GACCCCTCTCCTGTTGCTCAGGG - Intergenic
938483745 2:131682514-131682536 GACCACGCTGCTGCTGCTGCAGG - Intergenic
944206701 2:197164589-197164611 GCCCCCTCCCCTGCTGCTGCGGG + Intronic
946280903 2:218664792-218664814 CCCCCCGCTCCTGCTGCCTCTGG + Exonic
947506630 2:230712923-230712945 GCCCCCGCCCCGGCGCCTGAAGG - Exonic
947524225 2:230868697-230868719 GACCCAGCTCCTCCTGCCGAGGG - Intronic
947636822 2:231684494-231684516 GCACGTGCTCCTGCTGCTGCCGG + Intergenic
947716934 2:232345563-232345585 TGCCCTGCTCGTGCTGCTGAGGG + Intergenic
947859435 2:233348325-233348347 CCCACCGGGCCTGCTGCTGATGG + Intergenic
948138572 2:235656119-235656141 GGGGCCGCTCCTGCTGATGATGG + Intronic
948704470 2:239780297-239780319 GCCCCAGCCCCTGCTCCTGTGGG - Exonic
949014692 2:241702481-241702503 GCGCCAGCTCCTCCTGCAGACGG - Intronic
1168771181 20:417887-417909 GCTCCCGCTGCAGCTCCTGAGGG - Exonic
1169488494 20:6052766-6052788 CCTACCGCTGCTGCTGCTGACGG - Exonic
1171343820 20:24450973-24450995 GCCACTGCTCTGGCTGCTGAGGG + Intergenic
1172442182 20:34973606-34973628 GCAGCCTCTCCCGCTGCTGATGG + Intergenic
1172911232 20:38410759-38410781 GCCCACCCTCCTGCTGCTCCTGG + Intergenic
1173557284 20:43974821-43974843 GCCCCCTCCCCTGCCGCTGCAGG + Intronic
1174368142 20:50068675-50068697 TCCACAGCTCCTGCTGCTGTTGG + Intergenic
1175092716 20:56518276-56518298 GCCACCGCTCCTGCCCCAGAAGG + Exonic
1175853164 20:62104531-62104553 GTCCCCCCTCCTACTGCTGCCGG - Intergenic
1176100161 20:63361108-63361130 GCCGCCGCTGCTGCTGCTTCTGG - Exonic
1176126382 20:63477158-63477180 CTCCCCGATCCCGCTGCTGACGG - Intergenic
1176130095 20:63493155-63493177 GCCCCTGCGCCTGCCGCTGCAGG - Exonic
1176171094 20:63696665-63696687 GCCCCCGGTCCGCCTGCGGAGGG - Exonic
1176202620 20:63869373-63869395 GCCCGGACTCCTGCTGTTGAGGG + Exonic
1176300084 21:5095237-5095259 TCCCCAGCTCCTGCTGCAGTTGG - Intergenic
1177846266 21:26290992-26291014 GCCCTTTGTCCTGCTGCTGAAGG + Intergenic
1179374907 21:40841656-40841678 GCCGCCGCTTCTCCTGCTGATGG - Intronic
1179774896 21:43655478-43655500 GCCCCTGCTCCTGTGGCTGTAGG - Intronic
1179856938 21:44166674-44166696 TCCCCAGCTCCTGCTGCAGTTGG + Intergenic
1180064428 21:45405427-45405449 GCCCCTGGTCCTGCTGCTCGGGG + Intronic
1180475896 22:15706853-15706875 GCTCCCGCTCTTGCTGCTGCCGG + Intronic
1181032295 22:20154435-20154457 ACCCCCTCCCCTGCTGCTCAGGG - Intergenic
1181511170 22:23389293-23389315 GCCCCCTCCCCTGCTGCTCAAGG + Intergenic
1181850783 22:25748582-25748604 GCCCCAGGTTCTGATGCTGAGGG + Intronic
1183056199 22:35307647-35307669 GGCCTCGCTCCTGCTGGGGAAGG + Intronic
1184294617 22:43515649-43515671 GCCCCGGCTCTGGCTCCTGAGGG + Intergenic
1184647278 22:45903224-45903246 GACTCGGTTCCTGCTGCTGAGGG + Intergenic
1185068645 22:48644443-48644465 GCCCCAGCTCCTTCTGCCCATGG - Intronic
1185351648 22:50342875-50342897 GAGCCCGCTCCTGCTGCTCGGGG + Intergenic
949918796 3:8985594-8985616 GCCCGAGCTGCTGCTGCTGCTGG + Exonic
950538870 3:13598116-13598138 GCACCAGCTTCTACTGCTGAAGG + Intronic
950663415 3:14480958-14480980 GCCCAGGCCCCTGCTGCTGGTGG + Intronic
950673180 3:14539398-14539420 GCCCCCAGCCCTGCTTCTGAGGG - Intronic
953415370 3:42712604-42712626 TCTCCCCTTCCTGCTGCTGATGG + Intronic
953707648 3:45243438-45243460 GCCATGGCTCCTGCTGCTGCTGG + Intergenic
955531370 3:59876461-59876483 TCCCCAGCCCCTGCTGCTGTGGG + Intronic
956744404 3:72300197-72300219 ACCTCAGCCCCTGCTGCTGAAGG + Intergenic
959099703 3:101996541-101996563 TCCACAGCTCCTGCTGCTGTAGG - Intergenic
961449747 3:126997331-126997353 ACCACCTCTGCTGCTGCTGAAGG + Intronic
962807508 3:138938003-138938025 ACCCCCGATCCTGCCGGTGAGGG + Intergenic
965447227 3:168789931-168789953 GCCCTCGCTACAGCTGCTGTGGG - Intergenic
966231644 3:177658905-177658927 GCCTCTGGTCTTGCTGCTGAAGG + Intergenic
966787931 3:183636835-183636857 GCTCCCGCCCCTGCTGCGGGCGG + Intronic
967446593 3:189574142-189574164 GCCCCTGCTGCTGCTTCTGTTGG - Intergenic
967976149 3:195035737-195035759 GCCCCCATCCCTGCTGCTGAAGG - Intergenic
969125542 4:4945254-4945276 GCCCCTGCCTCTGCTGCTCATGG - Intergenic
969572788 4:8019860-8019882 GCCCCATCTCCTGCAGATGAGGG - Intronic
969621648 4:8281737-8281759 GCCACAGCCCCTACTGCTGACGG + Intronic
969675888 4:8614151-8614173 GACGCCCCTCCTGCAGCTGAGGG - Intronic
972089218 4:35258495-35258517 GCCTCCGCTGCTCCTTCTGAGGG - Intergenic
972635070 4:40877015-40877037 GCCCCCGACCCTGCTCCTGTGGG - Intronic
975571887 4:75826293-75826315 GCCCCCTCTCCTTTTGTTGAGGG - Intergenic
975585064 4:75940889-75940911 GTCCCTGCTGCTGCTGCTGCTGG - Exonic
977323673 4:95549160-95549182 GCGGCTGCTCCTGCTGCTGGGGG - Exonic
981034250 4:140153290-140153312 GCCCCCGCTGCTGCCGCGAATGG - Exonic
981070358 4:140529179-140529201 GCAGCCGTTCCTGCTGGTGAGGG + Intronic
981835895 4:149052902-149052924 GCCCCCGCTCATGCATCTGCTGG - Intergenic
982115468 4:152095187-152095209 GCCCTCACACCTGCTGCTGTAGG - Intergenic
983563197 4:169122172-169122194 ACCGCCGCTGCTGCTGCTGCTGG - Exonic
985869084 5:2539517-2539539 CCCCAAGCTTCTGCTGCTGAAGG - Intergenic
986447270 5:7832315-7832337 TTCCCAGCTCCTGCTGCTGCTGG + Intronic
988547757 5:32174156-32174178 GCCCCCGGCCCTGCTGCCGACGG - Exonic
991249186 5:64541115-64541137 GCCTCTGCTTCTGCTGGTGACGG + Intronic
992496889 5:77302499-77302521 GCACCCGCTCCCGCTGCAGTGGG - Intronic
997621894 5:135304558-135304580 GCCCGCGCTTCTCCTGCTGGGGG - Intronic
997949417 5:138230415-138230437 TCCCCAGCTCCTGCCTCTGAAGG + Intergenic
998094537 5:139389820-139389842 GCCACTGCTGCTGCTGCTGCTGG - Exonic
998399222 5:141839478-141839500 GCCCCAGCTCCAGCTCCTCAGGG - Intergenic
1001109697 5:168885459-168885481 GCCCCTGCTCCGGAGGCTGATGG - Intronic
1001423122 5:171601803-171601825 GCCCCAGAACCTGCTGCTGCTGG - Intergenic
1001482649 5:172099215-172099237 GCTGCTGCTCCTGCTGCTGACGG - Intronic
1001773098 5:174310356-174310378 TGCCCCCCTCCTGCTGCTAATGG - Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002421273 5:179150297-179150319 TGCCCCGCTCCTTCTGCTGAGGG + Intronic
1004720377 6:18263959-18263981 GCCTCGGCCCCTGCTGCGGAGGG - Exonic
1005734277 6:28731170-28731192 GCTCCCTCTCCTGCTCCTTAAGG - Intergenic
1006463513 6:34177502-34177524 GCTCCCTCTCCTGCTGCTAAGGG + Intergenic
1007350747 6:41271923-41271945 GCTGCTGCTCCTGCTGCTGCAGG - Intronic
1007829425 6:44627148-44627170 GCCCCAGCTCCACGTGCTGAGGG - Intergenic
1010887632 6:81263614-81263636 GCCCAGGCTCTTCCTGCTGAGGG + Intergenic
1013368736 6:109453335-109453357 GCTCCAGCTGCTTCTGCTGAAGG - Exonic
1014391650 6:120872355-120872377 GCCCACGCTGTTGGTGCTGAGGG - Intergenic
1015878917 6:137851456-137851478 GTCCCAGCTGCTGCTGCTGCTGG - Intergenic
1016753655 6:147660155-147660177 GCCCCGGCTCCTTTTGCAGAAGG + Intronic
1018244210 6:161806271-161806293 GCCACCGCTCCTGGAACTGACGG + Intronic
1018474164 6:164123724-164123746 GCCCTCGCACCTGCTCCAGACGG + Intergenic
1018911207 6:168101619-168101641 GCCCGCGCTCCTGCCGGGGAGGG - Intergenic
1019266488 7:120038-120060 GCCCTCGCTCCTGCTCCTCAGGG - Intergenic
1019416157 7:927370-927392 GCGGCCCCTCCTGCTGCTCAAGG - Intronic
1020094421 7:5360718-5360740 GCCCCTGCTGCGGCTGGTGAGGG + Intronic
1020560586 7:9726273-9726295 GCTCCTGCTCCTGCTGCTGTCGG + Intergenic
1021915082 7:25423472-25423494 GCCCCCATTCCTTCTGATGATGG + Intergenic
1023344867 7:39261209-39261231 GCCACCTCTCCTGCTCCTGCAGG + Intronic
1023418400 7:39951798-39951820 GCGCCAGCTGCTGCTGCTGTAGG - Exonic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG + Intergenic
1024994290 7:55260330-55260352 TCCGCTGCTACTGCTGCTGAGGG + Intergenic
1026151453 7:67791132-67791154 GCCCTCTCTCTTCCTGCTGAAGG - Intergenic
1027779219 7:82502172-82502194 GACCCAGGTCCTGCTGCTCACGG + Intergenic
1028168260 7:87564355-87564377 GCCCCTGCTTCTGCTGCTTGAGG + Intronic
1028364703 7:90013912-90013934 GCCCCCGCTCCCCCTGCCCAGGG - Intergenic
1029096041 7:98085857-98085879 GCCCCCACTCCCACTGCTGGGGG - Intergenic
1029459383 7:100686487-100686509 GCCCCCTCTGCTGCAGCTCACGG + Intronic
1029489328 7:100861793-100861815 GCCCCAGCTGCTGCTCCTGGTGG + Exonic
1030111619 7:106031568-106031590 GCCGCCGCTGCTGCTGCTGCTGG + Intronic
1030978422 7:116156077-116156099 GGCCCTGGTCCTGATGCTGAAGG + Intronic
1032084093 7:128874550-128874572 GCCCCCTGTACTGCTGCAGATGG - Intronic
1034414738 7:150958452-150958474 GCCCGCGCTGCTGGCGCTGACGG - Exonic
1034426349 7:151016208-151016230 GCTCCTGCTGCTGCTGCTGCTGG + Exonic
1034900843 7:154907052-154907074 GCACCCTCTGCTGCTGCTGCTGG - Intergenic
1035236843 7:157502797-157502819 GCCTTTGCTCCTGCTGCAGAGGG - Intergenic
1035448681 7:158960129-158960151 GCCAGTGCTCTTGCTGCTGAAGG - Intergenic
1035530160 8:345115-345137 GCCCCTGTTGCTGCTGCTGAGGG + Intergenic
1035530192 8:345283-345305 GCCCTCGTTCCTGCATCTGAGGG - Intergenic
1035560695 8:601680-601702 TCCCTCGCTCCTGATCCTGATGG - Intergenic
1037764253 8:21762205-21762227 GCCCCCACTCCTGGTGGTGAGGG - Intronic
1037825533 8:22158431-22158453 GTCCCCACCCCTGCAGCTGAGGG + Intronic
1037891326 8:22625248-22625270 GCTCTCGCTGCTGCTGCTGGAGG + Intronic
1038535316 8:28349311-28349333 TCCCCAGCTCCTGGTGCAGAAGG + Intronic
1039373922 8:37014306-37014328 CCCCATGCTCCTTCTGCTGAAGG + Intergenic
1041167204 8:55102132-55102154 GCTGCTGCTCCTGCTGCTGGCGG + Intergenic
1041201476 8:55454530-55454552 GGCCACGCTGCAGCTGCTGATGG + Intronic
1041384066 8:57280041-57280063 TTCCCCCCTCCTGCAGCTGAAGG - Intergenic
1043425491 8:80144454-80144476 GCTCCTGCTCCTGTTCCTGAGGG + Intronic
1048229111 8:132619891-132619913 CCCCTCTCTCCTGCTGCTGACGG - Intronic
1048472928 8:134719443-134719465 ACCCTCGCTGCTGCTGCTGCTGG - Intergenic
1048804598 8:138228389-138228411 ACACCCGCTCCTGCAGCTGGGGG - Intronic
1049097414 8:140557211-140557233 GCCCGCTCTCCTGCTGCAGCGGG + Exonic
1049097781 8:140558933-140558955 GCCCCCCATTCTGTTGCTGATGG + Intronic
1049219264 8:141421465-141421487 GTCGCCGCGCCTCCTGCTGAGGG + Exonic
1049222893 8:141435936-141435958 GCCCCTGCTCCTACACCTGAAGG - Intergenic
1049274539 8:141713198-141713220 AGGCCCACTCCTGCTGCTGATGG + Intergenic
1049427631 8:142544466-142544488 CCGCCCGCTCCTGCCGCAGACGG + Exonic
1049755748 8:144310658-144310680 GACCGCGCTCCTGCTGCTCTGGG - Intronic
1049778353 8:144416424-144416446 GCCCACCCTCCTGCTCATGAGGG - Intronic
1051774983 9:20622841-20622863 ACCCCCTCTCCGGCTGCTGAGGG - Intergenic
1053003188 9:34589236-34589258 GACCCCGCGCGTGCAGCTGAGGG + Intronic
1053104424 9:35398071-35398093 GCCCCAGCTCTTAGTGCTGAGGG + Intronic
1054870546 9:70044278-70044300 GCCCCCGCTCCTGCTGCCCCCGG + Intronic
1056579546 9:87880832-87880854 CCCCTTGCTCCTGCTGCTGCAGG - Intergenic
1056717000 9:89039917-89039939 GCTGCCGCTCCTGTTGCTGCTGG - Intronic
1056763600 9:89431254-89431276 GCTCCTGCTCCTGCTCCTGCGGG + Intronic
1056877620 9:90349718-90349740 TCACCCACACCTGCTGCTGATGG + Intergenic
1057763111 9:97892106-97892128 CCCCCAGATCCTGCTGCTGACGG - Intergenic
1059309171 9:113376804-113376826 GCCCCAGCTCACGCTGCCGACGG - Intronic
1059977840 9:119736928-119736950 GCCCACACTTCTGCAGCTGAGGG - Intergenic
1059990313 9:119859144-119859166 GCTTCCCCTTCTGCTGCTGAAGG - Intergenic
1061011132 9:127955292-127955314 GCCACCCCTTCTACTGCTGAGGG + Intronic
1061205236 9:129159199-129159221 GCCCCTACTCCTGGTGCTGGGGG - Intergenic
1061251304 9:129428130-129428152 GCCCCCACTCCTGGTCCTGTTGG + Intergenic
1061592035 9:131603864-131603886 TCCCCCGCACCTGCTTCTGTTGG - Intronic
1061666739 9:132164387-132164409 GCCGCGGGTCCTGCAGCTGAAGG + Intronic
1062396085 9:136353450-136353472 GCCCAGGGTCCTGCTTCTGAGGG + Intronic
1062546465 9:137065868-137065890 AGCCCCGTTCCTCCTGCTGAGGG + Intronic
1185643442 X:1600706-1600728 GCCGCCGCTCCTCCTGCTGCTGG - Exonic
1192248594 X:69392619-69392641 GCTCACGCTCCTGCGGGTGAAGG + Intergenic
1197754459 X:129984185-129984207 GCCGCCGCTGCTGCTCCTGCTGG + Intronic
1198236002 X:134736481-134736503 GCCCCGACTCCTGCTTCTTAAGG + Intronic
1199978318 X:152907216-152907238 GCCCCCGCTCCTCCAGCGCACGG + Intergenic
1200138162 X:153884977-153884999 GCCCCCACTCCTTCTGGAGAAGG + Intronic