ID: 904618968

View in Genome Browser
Species Human (GRCh38)
Location 1:31764185-31764207
Sequence CGCGCGCCGCCTCCTATTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904618959_904618968 0 Left 904618959 1:31764162-31764184 CCCGCCCCGAGCACCGCCCGCGC 0: 1
1: 0
2: 6
3: 63
4: 489
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618946_904618968 27 Left 904618946 1:31764135-31764157 CCGCGCCGCCCCCCGCTCCCCCG 0: 1
1: 1
2: 28
3: 328
4: 2177
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618958_904618968 1 Left 904618958 1:31764161-31764183 CCCCGCCCCGAGCACCGCCCGCG 0: 1
1: 0
2: 4
3: 54
4: 392
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618954_904618968 9 Left 904618954 1:31764153-31764175 CCCCGCTCCCCCGCCCCGAGCAC 0: 1
1: 0
2: 4
3: 71
4: 1596
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618961_904618968 -4 Left 904618961 1:31764166-31764188 CCCCGAGCACCGCCCGCGCCGCG 0: 1
1: 0
2: 2
3: 26
4: 252
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618963_904618968 -6 Left 904618963 1:31764168-31764190 CCGAGCACCGCCCGCGCCGCGCG 0: 1
1: 2
2: 5
3: 33
4: 312
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618947_904618968 22 Left 904618947 1:31764140-31764162 CCGCCCCCCGCTCCCCCGCTCCC 0: 2
1: 2
2: 49
3: 672
4: 6222
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618949_904618968 18 Left 904618949 1:31764144-31764166 CCCCCGCTCCCCCGCTCCCCCGC 0: 1
1: 2
2: 27
3: 267
4: 2013
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618960_904618968 -1 Left 904618960 1:31764163-31764185 CCGCCCCGAGCACCGCCCGCGCC 0: 1
1: 0
2: 3
3: 70
4: 522
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618951_904618968 16 Left 904618951 1:31764146-31764168 CCCGCTCCCCCGCTCCCCCGCCC 0: 1
1: 3
2: 30
3: 386
4: 2763
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618957_904618968 2 Left 904618957 1:31764160-31764182 CCCCCGCCCCGAGCACCGCCCGC 0: 1
1: 1
2: 8
3: 56
4: 661
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618956_904618968 7 Left 904618956 1:31764155-31764177 CCGCTCCCCCGCCCCGAGCACCG 0: 1
1: 0
2: 4
3: 95
4: 1701
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618955_904618968 8 Left 904618955 1:31764154-31764176 CCCGCTCCCCCGCCCCGAGCACC 0: 1
1: 0
2: 7
3: 67
4: 838
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618962_904618968 -5 Left 904618962 1:31764167-31764189 CCCGAGCACCGCCCGCGCCGCGC 0: 1
1: 0
2: 2
3: 38
4: 260
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618948_904618968 19 Left 904618948 1:31764143-31764165 CCCCCCGCTCCCCCGCTCCCCCG 0: 1
1: 3
2: 23
3: 224
4: 1981
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618953_904618968 10 Left 904618953 1:31764152-31764174 CCCCCGCTCCCCCGCCCCGAGCA 0: 1
1: 0
2: 8
3: 76
4: 719
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618950_904618968 17 Left 904618950 1:31764145-31764167 CCCCGCTCCCCCGCTCCCCCGCC 0: 1
1: 3
2: 19
3: 251
4: 2280
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
904618952_904618968 15 Left 904618952 1:31764147-31764169 CCGCTCCCCCGCTCCCCCGCCCC 0: 1
1: 4
2: 90
3: 871
4: 6083
Right 904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904618968 Original CRISPR CGCGCGCCGCCTCCTATTTG CGG Intronic
903879655 1:26500384-26500406 CGGGCGCCGCCTCCCAGGTGGGG - Intergenic
904618968 1:31764185-31764207 CGCGCGCCGCCTCCTATTTGCGG + Intronic
904619044 1:31764440-31764462 CGCGCGCCGCCTCCTGTTAAAGG + Intronic
924944693 1:248838419-248838441 CGCGCGCGGCCTCCGAGTGGGGG - Exonic
1070942049 10:80356798-80356820 CGCGCGCCCCTTCCGCTTTGCGG - Intronic
1074121698 10:110498166-110498188 AGCGCGCCGCCGCCTCCTTGCGG - Exonic
1083372159 11:62190682-62190704 CCCGCGCCTCCTCCTATCTCTGG + Intronic
1083635312 11:64117640-64117662 CGCTCCCCGCCTCCTCTTTCCGG + Exonic
1108555265 13:51584979-51585001 TGCGCGCCGCCTCCGCTGTGTGG + Intronic
1137531703 16:49282227-49282249 GGCGCGCCGCCTCCTACCTGAGG - Intergenic
1146794747 17:35773298-35773320 TGCGCGCCGCCTTCCAGTTGTGG - Exonic
1160835405 19:1122518-1122540 CGCGCTCCGCATCGTACTTGAGG + Exonic
925475054 2:4204128-4204150 CAAGCGTGGCCTCCTATTTGAGG - Intergenic
935796029 2:106642309-106642331 TGCTGGCCGCCCCCTATTTGGGG - Intergenic
948388248 2:237595007-237595029 AGCGCGCCCCCTCCTCCTTGGGG + Exonic
950902954 3:16513521-16513543 CCCGCGCCGCCTCCTCTGTATGG - Exonic
956678321 3:71754847-71754869 CGCGCGCCGCCTCCTCGTGCTGG + Exonic
975661089 4:76689604-76689626 CGCGCGCCGCCTCCTCGGAGCGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
997984058 5:138489810-138489832 CTCTCCCCGCCTCCTTTTTGCGG + Intergenic
999461205 5:151758735-151758757 GCCGCGCCGCCTCCTTTCTGCGG + Exonic
1018856224 6:167677301-167677323 CGCCCGCAGCCTGCTCTTTGTGG - Intergenic
1019637044 7:2081539-2081561 CGCCCCCCGCCTCCTGTGTGGGG - Intronic
1022375185 7:29806277-29806299 CGCGCAACAGCTCCTATTTGGGG + Intergenic
1041304619 8:56446678-56446700 CGCGCGCCTCCTTCGGTTTGGGG - Intronic