ID: 904619159

View in Genome Browser
Species Human (GRCh38)
Location 1:31765109-31765131
Sequence CTACACAAACAGATGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904619159_904619160 18 Left 904619159 1:31765109-31765131 CCATGTTGCATCTGTTTGTGTAG 0: 1
1: 0
2: 0
3: 6
4: 166
Right 904619160 1:31765150-31765172 GACCCACCCCTTCCCCATCTTGG 0: 1
1: 1
2: 1
3: 34
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904619159 Original CRISPR CTACACAAACAGATGCAACA TGG (reversed) Intergenic
900851749 1:5148989-5149011 CTTCACAAACATATGCAATATGG + Intergenic
902103570 1:14014192-14014214 CAACAGACACAGTTGCAACATGG - Intergenic
904619159 1:31765109-31765131 CTACACAAACAGATGCAACATGG - Intergenic
905518764 1:38581473-38581495 AAACACAAGCAGAGGCAACATGG - Intergenic
905853229 1:41289773-41289795 TTTCAAAAACAGAAGCAACAGGG + Intergenic
907697774 1:56751200-56751222 CTACCTAAACATATGCAAAAGGG + Exonic
907819780 1:57955809-57955831 CTAGAAAAACAAATGCACCAAGG + Intronic
908354237 1:63316132-63316154 GTACACTAACAGATGTGACATGG - Intergenic
909221372 1:72965758-72965780 CTACACAAAAGAATGCCACAGGG - Intergenic
909398499 1:75197825-75197847 CTACACAAACTCATGGAACAGGG + Intergenic
910704358 1:90111388-90111410 CTAGACCAACCGAGGCAACATGG - Intergenic
912738562 1:112172544-112172566 CTACACTCAGAGATGGAACAAGG + Intergenic
915263921 1:154701084-154701106 CTACACAAACAGACTGAAAACGG + Exonic
919232649 1:194794438-194794460 ATACACAAACACATGCATAAAGG + Intergenic
920240485 1:204544703-204544725 GCACACAAACAGAATCAACATGG - Intronic
924167416 1:241298925-241298947 ATACAAAAACAAATGTAACAAGG + Intronic
1072876851 10:99181906-99181928 ATATACAAAGAGATGCACCAGGG + Intronic
1073451490 10:103612270-103612292 CTACACAGGCAGTTTCAACAGGG - Intronic
1076035260 10:127195095-127195117 CTACCCAAAAATATGCCACAGGG - Intronic
1077458466 11:2695289-2695311 CTACACAAACAGCTTCTCCAGGG + Intronic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1090200181 11:124848506-124848528 CTACACAATGAGATGCATCTAGG - Intergenic
1090369088 11:126234743-126234765 CTTCAGAAACAGAAGCAAGATGG + Intronic
1092396996 12:8135453-8135475 CTCCACACTCAGATGCAACCAGG - Intronic
1092911763 12:13151860-13151882 CTACACAAACACCTGCCTCACGG + Intergenic
1093307939 12:17542943-17542965 CCACATAAACAGAAGCAAAAAGG - Intergenic
1094678189 12:32642540-32642562 CTACCAAAACAGAAGTAACATGG + Exonic
1098872321 12:75830542-75830564 CTACAGTAACAGAAGCAGCATGG + Intergenic
1101525590 12:105526018-105526040 CTCCACAAACAGAAGCAGAATGG - Intergenic
1104837556 12:131801385-131801407 CTCCGCAATCAGATGCAACCGGG + Intergenic
1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG + Intronic
1109374577 13:61474573-61474595 CTACACAAACAGACTTATCATGG + Intergenic
1110028764 13:70577644-70577666 CTCCAAAAACATAAGCAACAAGG + Intergenic
1111195240 13:84867761-84867783 CTAGACAAACAGGTCCTACATGG + Intergenic
1111670648 13:91325459-91325481 ATACACAAACAAATACAAAATGG + Intergenic
1111865086 13:93758226-93758248 ATAAACAAAAAGAGGCAACAGGG + Intronic
1115420330 14:33186732-33186754 CTAAACAAAAAAATTCAACAAGG - Intronic
1118720689 14:68591687-68591709 CCCCACAACCAGCTGCAACAAGG + Intronic
1118794715 14:69131161-69131183 ATACAAAGACAGATGCAAAATGG + Intronic
1120667527 14:87324461-87324483 TTACACACACAGAGGCATCACGG - Intergenic
1123008192 14:105334416-105334438 CTACACAGACAGAGGGAAGAGGG - Intronic
1124184359 15:27510421-27510443 CAACAAAAACTGGTGCAACAGGG - Intronic
1124853716 15:33366570-33366592 CTACTCAATCTGAGGCAACAGGG + Intronic
1128564769 15:68693654-68693676 GTCCACAAACGGATGGAACAAGG - Intronic
1130765089 15:86862023-86862045 GTACACAAGCAGAAGGAACAGGG - Intronic
1131815865 15:96220568-96220590 CTACACAAACAGATGTGCTATGG + Intergenic
1131890570 15:96967672-96967694 CTACACAAACAAATGAAAGGCGG - Intergenic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1138460786 16:57146528-57146550 TTCCACAAACTGATGGAACATGG + Intronic
1141703042 16:85651164-85651186 CTCCACAGACAGACGCATCAGGG - Intronic
1146089617 17:29863271-29863293 CAACAGAAACAGAAGCCACAGGG - Intronic
1147368228 17:39973607-39973629 CTACACACACATCTGCAACTCGG + Intronic
1149088347 17:52748283-52748305 ATACATATACATATGCAACAGGG + Intergenic
1151813237 17:76457673-76457695 TTACACACACAAATACAACATGG - Intronic
1152305617 17:79518722-79518744 CTTCCCTAACAGAAGCAACACGG + Intergenic
1157219287 18:45814383-45814405 CTACATAACTAAATGCAACATGG + Intergenic
1158232757 18:55277174-55277196 CCACAGAAACAGTTGCATCATGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159194432 18:65094309-65094331 CAACAAAAACAGAAGAAACAGGG + Intergenic
1160770852 19:830286-830308 CAACACATACAGATGTACCACGG + Intronic
1160973236 19:1779703-1779725 CCAGACACACAGATGCGACACGG - Exonic
1162311782 19:9912491-9912513 CCCCCCAAACAGATGGAACAGGG + Intronic
1164021647 19:21312463-21312485 CAAAACAAACAAATACAACATGG + Intronic
925353767 2:3222842-3222864 CTACACAAACAGAAGCTTCGTGG + Intronic
925380842 2:3424857-3424879 ATGTACAAACAGATGCACCAGGG - Intronic
925758516 2:7159396-7159418 ATATACATACAGATGAAACATGG - Intergenic
928447761 2:31348137-31348159 CTACACGGACATAAGCAACAGGG + Intronic
929019002 2:37531683-37531705 ACACACAAACAGAGGCAAGAAGG + Intergenic
929173108 2:38950911-38950933 CTACAAAAATACATGCAGCAGGG - Intronic
929810535 2:45185782-45185804 CTAGGCAATCAGATGAAACATGG + Intergenic
933460970 2:82584990-82585012 CAACACAAACAGATGCACTGTGG - Intergenic
936847638 2:116855828-116855850 AAACACAATCAGAAGCAACAAGG + Intergenic
938643766 2:133310367-133310389 CTCCTCAAACAGCTGCAACCTGG + Intronic
939649401 2:144742803-144742825 CTGCAAAAACAGCTGCAAAATGG - Intergenic
940502458 2:154510095-154510117 CAACATAAAAAGATTCAACAGGG + Intergenic
944363546 2:198889506-198889528 CTACACACACACATGCTTCAAGG + Intergenic
945502491 2:210593334-210593356 CTACACAACCAGTTGCCATAGGG - Intronic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
946284734 2:218694403-218694425 CTCCAGAAACAGATGCAAATTGG - Intronic
948276842 2:236715426-236715448 TTTCACTAACTGATGCAACATGG - Intergenic
1168937319 20:1676667-1676689 CTAGACAAAGAGAAACAACACGG - Intergenic
1172830907 20:37833557-37833579 ACACACACACAGAAGCAACAAGG - Intronic
1175408171 20:58748525-58748547 GTACACAAAAAAATGTAACAAGG + Intergenic
1175517959 20:59580860-59580882 CTAGACACACAGAAGCAAAAGGG + Intronic
1178474315 21:32922954-32922976 ATACAGTAACTGATGCAACAGGG + Intergenic
1179059799 21:37969311-37969333 CTACACTCACAGAAGCAAAACGG - Intronic
1179066897 21:38033404-38033426 CTACCCAAACAAATTCAAAATGG - Intronic
1181763007 22:25070779-25070801 TTACACACACAGAGGCAAGAGGG - Intronic
1184453957 22:44598703-44598725 CTTCACAAACGGATGCCACAGGG + Intergenic
949296237 3:2527258-2527280 CCACATAAAAAGATGAAACAGGG - Intronic
949296856 3:2534668-2534690 CCACATAAAAAGATGAAACAGGG - Intronic
951692913 3:25416067-25416089 CTGAAGAAAAAGATGCAACAAGG + Intronic
953621613 3:44537674-44537696 CCACCCAAACAGTGGCAACAAGG - Intergenic
957044441 3:75363049-75363071 CTACACAATCAGGTTCGACAGGG + Intergenic
960502416 3:118454234-118454256 CTAAAGAAACCGAGGCAACAAGG - Intergenic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
961352656 3:126313916-126313938 TTACACAAACAGATGGTAGACGG - Intergenic
961666060 3:128493680-128493702 CCATACAATCAGATGCAACTCGG + Intergenic
963722437 3:148877887-148877909 CCACATAAACACAGGCAACAAGG - Intronic
963736767 3:149026176-149026198 CTACAAGAACAGATGCTACTTGG + Intronic
964168410 3:153736981-153737003 GGACACAAACAAATGGAACATGG + Intergenic
964661001 3:159120394-159120416 CTACACAATCAGCTGGAAGATGG + Intronic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
969793756 4:9509940-9509962 CTACACAACCAGACTCGACAGGG - Intergenic
970370592 4:15401907-15401929 CAACACAAACTGAAGCAAAAGGG + Intronic
973649977 4:52989135-52989157 CTACAGAAACAAATGAACCAGGG - Intronic
974360794 4:60876474-60876496 CTACAGCAACAAAAGCAACATGG - Intergenic
976521138 4:86028341-86028363 ATACCCAAACAGATGCAATTCGG - Intronic
976831583 4:89320938-89320960 CTGCACAAATAGATGCTTCAGGG + Intergenic
977486650 4:97656534-97656556 GTACACAAAGAGAAGCAAGAAGG - Intronic
980014472 4:127632947-127632969 CTTCCCAAGCAGAGGCAACATGG + Exonic
980772144 4:137388716-137388738 ATACACATACATATACAACAAGG - Intergenic
981694045 4:147541696-147541718 TCACACAAACAGATGAAACTCGG + Intronic
982068635 4:151675706-151675728 CAAGACAAACAGATGTAACAAGG + Intronic
982598706 4:157418223-157418245 CTACAGTAACAAAAGCAACATGG + Intergenic
986059631 5:4175743-4175765 CTATATAAACACATGAAACAGGG - Intergenic
986643543 5:9894431-9894453 ACACACAAACAGAGGCAGCAGGG + Intergenic
992344963 5:75867288-75867310 CTTCAGTAGCAGATGCAACAGGG + Intergenic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
994914063 5:105949743-105949765 CTAGACTAAAATATGCAACAGGG + Intergenic
996050551 5:118927476-118927498 TTACACAAACAGATTCAAAAGGG - Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
1000732027 5:164846701-164846723 CTACAGTAACAAAAGCAACATGG - Intergenic
1002117053 5:176970710-176970732 CTCCACAAACTTTTGCAACATGG + Intronic
1002760574 6:198697-198719 ATAGAAAAATAGATGCAACAGGG + Intergenic
1003158522 6:3616726-3616748 CCACACAAACAGGTGGCACAAGG + Intergenic
1003387734 6:5684578-5684600 ATAAACAAAAAGCTGCAACAAGG + Intronic
1003865484 6:10358776-10358798 ATGCACAAACAAATGCACCAAGG + Intergenic
1006173000 6:32106191-32106213 CTCCACAAACACATACAACTGGG - Intronic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1010429475 6:75762554-75762576 CTACACAAACAGTAGTAAAATGG + Intronic
1013393447 6:109710829-109710851 AAACACAATCAGAAGCAACAAGG - Intronic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1019112363 6:169725847-169725869 CTACACAAAAAAATGCTTCAAGG + Intergenic
1020669399 7:11087723-11087745 CCACACACACAGATGAAGCATGG - Intronic
1020821533 7:12974125-12974147 ATACACAAAGAAATGCAAAAAGG - Intergenic
1021351964 7:19604876-19604898 TTAGATAAACAGAAGCAACAGGG - Intergenic
1021464060 7:20921768-20921790 CTACACTAAGAGATCCAAAATGG - Intergenic
1023329847 7:39103421-39103443 CTAGACAAAGAGATGTTACATGG + Intronic
1031935011 7:127727191-127727213 CTCCCCAAACAAAGGCAACAAGG - Intronic
1032118531 7:129138481-129138503 GTACACATACTAATGCAACACGG + Intergenic
1035868075 8:3106482-3106504 CTACATAAACTTATTCAACATGG - Intronic
1036126082 8:6063600-6063622 GTGCACAAACAGATGTAAAAAGG - Intergenic
1038137336 8:24801997-24802019 CTATACCTTCAGATGCAACATGG - Intergenic
1039533599 8:38287146-38287168 CTACAGAAATAGATGCACAAAGG + Intronic
1039645233 8:39275093-39275115 CTAGACACAGAGATGCATCAGGG - Intronic
1041639709 8:60183872-60183894 CTTCACAAACAACTCCAACATGG - Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1047094944 8:121614877-121614899 TTCCACAAACTCATGCAACAAGG + Exonic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1050093585 9:2040703-2040725 ATAGACTAACAGATTCAACATGG + Intronic
1051651857 9:19334426-19334448 TTACTCAAACAAATGGAACATGG + Intronic
1051810416 9:21042345-21042367 ACACACAAACAGTTGCAAGATGG + Intergenic
1053056014 9:34993497-34993519 CTACACAAACTGGTGCACCTGGG - Intronic
1055442151 9:76347183-76347205 CTACACAGAAAGATGCAGCTTGG - Intronic
1055857845 9:80712793-80712815 CTGCACAAACTTAAGCAACAAGG + Intergenic
1057962948 9:99474345-99474367 CTACAAAAATAGATGCAATCTGG + Intergenic
1059000722 9:110345723-110345745 ATACACAAACAGATCGCACATGG + Intergenic
1059483979 9:114612776-114612798 CAAAACAAACAATTGCAACAAGG - Intronic
1059784240 9:117563358-117563380 GTACACAAACACATGCACCCTGG - Intergenic
1185521655 X:744707-744729 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185522645 X:752997-753019 CCAGAGAAACAGATTCAACAGGG - Intergenic
1187193778 X:17061310-17061332 ATACAAAGACAGATGAAACAGGG + Intronic
1187598599 X:20801871-20801893 CTCCACAGACAAATTCAACAGGG + Intergenic
1188376820 X:29441350-29441372 TTGCACAAACATATTCAACAAGG - Intronic
1190267260 X:48834975-48834997 CTACACACCCAGACGCACCACGG + Intronic
1195961355 X:110390213-110390235 GTACATAAATATATGCAACATGG + Intronic
1197316814 X:124976760-124976782 CTACATAACCAGATGAAAGAGGG + Intergenic
1197969823 X:132102843-132102865 ATATACAAACACATGGAACATGG - Intronic
1199269796 X:145869834-145869856 AAACACAATCAGAAGCAACAAGG - Intergenic
1200391706 X:155952190-155952212 CTTAACAAAAAGATGCAGCAAGG + Intergenic
1202599980 Y:26583514-26583536 CTAAACAAATAGAAGCAAAAGGG - Intergenic