ID: 904619647

View in Genome Browser
Species Human (GRCh38)
Location 1:31767519-31767541
Sequence GTGGTGAACAGGGCTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904619647_904619653 3 Left 904619647 1:31767519-31767541 CCTCACTCAGCCCTGTTCACCAC No data
Right 904619653 1:31767545-31767567 CGTTCAACTAGGCACCATCCAGG No data
904619647_904619658 21 Left 904619647 1:31767519-31767541 CCTCACTCAGCCCTGTTCACCAC No data
Right 904619658 1:31767563-31767585 CCAGGGCCACCCAAAGCTGTGGG No data
904619647_904619660 29 Left 904619647 1:31767519-31767541 CCTCACTCAGCCCTGTTCACCAC No data
Right 904619660 1:31767571-31767593 ACCCAAAGCTGTGGGTGCCAAGG No data
904619647_904619656 20 Left 904619647 1:31767519-31767541 CCTCACTCAGCCCTGTTCACCAC No data
Right 904619656 1:31767562-31767584 TCCAGGGCCACCCAAAGCTGTGG No data
904619647_904619654 4 Left 904619647 1:31767519-31767541 CCTCACTCAGCCCTGTTCACCAC No data
Right 904619654 1:31767546-31767568 GTTCAACTAGGCACCATCCAGGG No data
904619647_904619650 -8 Left 904619647 1:31767519-31767541 CCTCACTCAGCCCTGTTCACCAC No data
Right 904619650 1:31767534-31767556 TTCACCACTGCCGTTCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904619647 Original CRISPR GTGGTGAACAGGGCTGAGTG AGG (reversed) Intergenic
No off target data available for this crispr