ID: 904619823

View in Genome Browser
Species Human (GRCh38)
Location 1:31768485-31768507
Sequence CTGTGGCTGCAGCATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904619823_904619828 21 Left 904619823 1:31768485-31768507 CCCACACCATGCTGCAGCCACAG No data
Right 904619828 1:31768529-31768551 AAAACTCCAAACCCTTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904619823 Original CRISPR CTGTGGCTGCAGCATGGTGT GGG (reversed) Intergenic