ID: 904620580

View in Genome Browser
Species Human (GRCh38)
Location 1:31772834-31772856
Sequence CCCCTGTGTGCCCGCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904620571_904620580 2 Left 904620571 1:31772809-31772831 CCCTCCCTCCGCCCCGCGCTATG No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620565_904620580 25 Left 904620565 1:31772786-31772808 CCTCCACGGACGGTGCCGCCACC No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620574_904620580 -3 Left 904620574 1:31772814-31772836 CCTCCGCCCCGCGCTATGTGCCC No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620564_904620580 26 Left 904620564 1:31772785-31772807 CCCTCCACGGACGGTGCCGCCAC No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620569_904620580 4 Left 904620569 1:31772807-31772829 CCCCCTCCCTCCGCCCCGCGCTA No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620567_904620580 10 Left 904620567 1:31772801-31772823 CCGCCACCCCCTCCCTCCGCCCC No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620573_904620580 -2 Left 904620573 1:31772813-31772835 CCCTCCGCCCCGCGCTATGTGCC No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620568_904620580 7 Left 904620568 1:31772804-31772826 CCACCCCCTCCCTCCGCCCCGCG No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620577_904620580 -10 Left 904620577 1:31772821-31772843 CCCGCGCTATGTGCCCCTGTGTG No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620575_904620580 -6 Left 904620575 1:31772817-31772839 CCGCCCCGCGCTATGTGCCCCTG No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620572_904620580 1 Left 904620572 1:31772810-31772832 CCTCCCTCCGCCCCGCGCTATGT No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620566_904620580 22 Left 904620566 1:31772789-31772811 CCACGGACGGTGCCGCCACCCCC No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620576_904620580 -9 Left 904620576 1:31772820-31772842 CCCCGCGCTATGTGCCCCTGTGT No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data
904620570_904620580 3 Left 904620570 1:31772808-31772830 CCCCTCCCTCCGCCCCGCGCTAT No data
Right 904620580 1:31772834-31772856 CCCCTGTGTGCCCGCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904620580 Original CRISPR CCCCTGTGTGCCCGCGCCGC CGG Intergenic