ID: 904623059

View in Genome Browser
Species Human (GRCh38)
Location 1:31787107-31787129
Sequence ACCCCTTAAGTGTGCTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904623059_904623065 15 Left 904623059 1:31787107-31787129 CCTATCCAGCACACTTAAGGGGT No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data
904623059_904623066 29 Left 904623059 1:31787107-31787129 CCTATCCAGCACACTTAAGGGGT No data
Right 904623066 1:31787159-31787181 AGAACAGGGAACTCCCTCCATGG No data
904623059_904623064 14 Left 904623059 1:31787107-31787129 CCTATCCAGCACACTTAAGGGGT No data
Right 904623064 1:31787144-31787166 GCTTGCACAGTGCAAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904623059 Original CRISPR ACCCCTTAAGTGTGCTGGAT AGG (reversed) Intergenic
No off target data available for this crispr