ID: 904623060

View in Genome Browser
Species Human (GRCh38)
Location 1:31787112-31787134
Sequence GAGGGACCCCTTAAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904623060_904623066 24 Left 904623060 1:31787112-31787134 CCAGCACACTTAAGGGGTCCCTC No data
Right 904623066 1:31787159-31787181 AGAACAGGGAACTCCCTCCATGG No data
904623060_904623064 9 Left 904623060 1:31787112-31787134 CCAGCACACTTAAGGGGTCCCTC No data
Right 904623064 1:31787144-31787166 GCTTGCACAGTGCAAAGAACAGG No data
904623060_904623065 10 Left 904623060 1:31787112-31787134 CCAGCACACTTAAGGGGTCCCTC No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904623060 Original CRISPR GAGGGACCCCTTAAGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr