ID: 904623063

View in Genome Browser
Species Human (GRCh38)
Location 1:31787131-31787153
Sequence CTGTGCAAGCAGAAGCCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904623063_904623065 -9 Left 904623063 1:31787131-31787153 CCTCTCGGCTTCTGCTTGCACAG No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data
904623063_904623064 -10 Left 904623063 1:31787131-31787153 CCTCTCGGCTTCTGCTTGCACAG No data
Right 904623064 1:31787144-31787166 GCTTGCACAGTGCAAAGAACAGG No data
904623063_904623066 5 Left 904623063 1:31787131-31787153 CCTCTCGGCTTCTGCTTGCACAG No data
Right 904623066 1:31787159-31787181 AGAACAGGGAACTCCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904623063 Original CRISPR CTGTGCAAGCAGAAGCCGAG AGG (reversed) Intergenic
No off target data available for this crispr