ID: 904623065

View in Genome Browser
Species Human (GRCh38)
Location 1:31787145-31787167
Sequence CTTGCACAGTGCAAAGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904623062_904623065 -8 Left 904623062 1:31787130-31787152 CCCTCTCGGCTTCTGCTTGCACA No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data
904623059_904623065 15 Left 904623059 1:31787107-31787129 CCTATCCAGCACACTTAAGGGGT No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data
904623060_904623065 10 Left 904623060 1:31787112-31787134 CCAGCACACTTAAGGGGTCCCTC No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data
904623063_904623065 -9 Left 904623063 1:31787131-31787153 CCTCTCGGCTTCTGCTTGCACAG No data
Right 904623065 1:31787145-31787167 CTTGCACAGTGCAAAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904623065 Original CRISPR CTTGCACAGTGCAAAGAACA GGG Intergenic
No off target data available for this crispr