ID: 904623415

View in Genome Browser
Species Human (GRCh38)
Location 1:31789040-31789062
Sequence CAGTTGGTATGGAGGGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904623415_904623423 4 Left 904623415 1:31789040-31789062 CCCGTTTCCCTCCATACCAACTG 0: 1
1: 0
2: 2
3: 7
4: 201
Right 904623423 1:31789067-31789089 AGGAAAACCACCCAAACTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 195
904623415_904623422 3 Left 904623415 1:31789040-31789062 CCCGTTTCCCTCCATACCAACTG 0: 1
1: 0
2: 2
3: 7
4: 201
Right 904623422 1:31789066-31789088 TAGGAAAACCACCCAAACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 213
904623415_904623427 23 Left 904623415 1:31789040-31789062 CCCGTTTCCCTCCATACCAACTG 0: 1
1: 0
2: 2
3: 7
4: 201
Right 904623427 1:31789086-31789108 TGGGCTCAGAACCAAGCTGTAGG 0: 1
1: 0
2: 1
3: 23
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904623415 Original CRISPR CAGTTGGTATGGAGGGAAAC GGG (reversed) Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900555639 1:3279050-3279072 AAGTTGACATGGAGAGAAACTGG - Intronic
904274637 1:29372327-29372349 CAGTTGTGATGGAAGGAGACTGG + Intergenic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
906535862 1:46550626-46550648 CAGCTGCTGTGGAGGCAAACAGG + Intronic
906844363 1:49175223-49175245 AAGTTGATAAGGAGGGAAATGGG + Intronic
907115688 1:51966470-51966492 CAGTTTGGATGGAAGGAAAGGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
908611518 1:65865887-65865909 GAGTTGGGATGGAGGGAGAGAGG - Intronic
909046771 1:70720283-70720305 CAGTTGGTCTCAAGGGAAAAGGG - Intergenic
910527675 1:88199600-88199622 TAGTTGGTTTTGAGTGAAACTGG - Intergenic
910971825 1:92863697-92863719 AAGTTGGTATAAAGGGAAAAGGG + Intronic
911460396 1:98181991-98182013 CCTTTGGTATGGAGGAAAATGGG - Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912775458 1:112504021-112504043 CAGGTGGTAGGGAGAGAAAGAGG + Intronic
912976778 1:114338045-114338067 CAGTTGATATTCAGGGAATCTGG + Intergenic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
914406972 1:147385154-147385176 AAGTTGGCTTGAAGGGAAACAGG - Intergenic
915646417 1:157275980-157276002 CCGTTGGTATAGAGGGAGAAAGG + Intergenic
915665541 1:157440917-157440939 CAGTTGGCATTGAGGGAATGTGG - Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
919382420 1:196875493-196875515 CAGCTAATATGGTGGGAAACAGG - Intronic
919935674 1:202248970-202248992 GAGTTGGAATGAAGGGAAAGAGG + Intronic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
921986250 1:221316063-221316085 CAGTTGGGATGCAGGGGTACTGG - Intergenic
923230481 1:231981929-231981951 CAGTTGGTATGTAGAGAAGTGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063233659 10:4090306-4090328 CAGTTGGGGTGGAAAGAAACAGG - Intergenic
1064078180 10:12287022-12287044 TACTTGGTTTGGAGGGAAAAAGG - Intergenic
1065159924 10:22908980-22909002 CAGTTGGAATGCAGGGCACCAGG + Intergenic
1066288140 10:33988518-33988540 CAGTTGGTCTGGAAGAAAAGAGG - Intergenic
1067529249 10:47058623-47058645 CAGTGCATTTGGAGGGAAACTGG - Intergenic
1068542178 10:58307247-58307269 AAGTTGTCATGGAGGGACACTGG + Intergenic
1069312929 10:67061460-67061482 CAAATGGTATGGAGAGAAGCAGG - Intronic
1070080701 10:73183857-73183879 CAGTAGGTTTGGAGTGAACCTGG + Intronic
1070104544 10:73418770-73418792 CAGTAGGTATGGAGAGCAAGAGG - Intergenic
1076452236 10:130564856-130564878 CAGCTGTTGGGGAGGGAAACGGG - Intergenic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077574978 11:3376106-3376128 GAGTTGGGATGGAAGGAAGCTGG - Intronic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1084253718 11:67923425-67923447 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1085557494 11:77438173-77438195 CAGAAGGTAAAGAGGGAAACAGG + Intronic
1087705743 11:101489981-101490003 CTGTTGGTGTGTATGGAAACTGG + Intronic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1089982646 11:122785147-122785169 CAATTGGCATGGAAGGAAAAAGG + Intronic
1090175442 11:124644919-124644941 CAGTTGGTCTGTAAGGAAAGAGG - Intronic
1090721184 11:129474746-129474768 CAGGTGTTATGGAGGTAACCAGG - Intergenic
1092423791 12:8356812-8356834 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1092781234 12:11989359-11989381 CAGTTGGTAGGAATGTAAACTGG - Intergenic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1101391543 12:104304825-104304847 CAGTTGCCATGGCAGGAAACAGG + Exonic
1101975545 12:109354993-109355015 CATTTGGTATGGAGGAAAAGGGG + Intronic
1102721235 12:115018144-115018166 CAGGTAGTAAGTAGGGAAACAGG + Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104793813 12:131501899-131501921 CAGGTGTTGTGGATGGAAACTGG - Intergenic
1106349065 13:28910158-28910180 CGGGTGGGATGGAGGGAAATGGG - Intronic
1106948616 13:34857271-34857293 CAGCTGGTAAGTAGGAAAACTGG - Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114707935 14:24746346-24746368 CAGGAGGTAGGGAGGGACACAGG + Intergenic
1116273441 14:42801304-42801326 CAGTTGGGATATAGGGACACAGG + Intergenic
1117823917 14:59680282-59680304 TAACTGGTATGGAGGGAAAGAGG - Intronic
1120841649 14:89090898-89090920 CAGTAGGAATGAAGAGAAACAGG - Intergenic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1124790764 15:32724373-32724395 CAGGAGGTATGGAGGAAGACTGG + Intronic
1125954154 15:43777568-43777590 CAGTTGGTGGGCAGGGATACGGG + Intronic
1126258955 15:46664247-46664269 CTGTTGGTGGGAAGGGAAACTGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1129321239 15:74776239-74776261 CAGTTGCTAGGTAGGGAAACAGG + Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1133610966 16:7432971-7432993 CAGCTTCTGTGGAGGGAAACAGG + Intronic
1137852375 16:51758715-51758737 TACTTGGGAAGGAGGGAAACTGG + Intergenic
1138128643 16:54459506-54459528 CAGTTGTCATGAAAGGAAACTGG + Intergenic
1138795434 16:59962664-59962686 CAGTTGGAAGGGAGGGACATCGG + Intergenic
1138967664 16:62105051-62105073 CAGTTTTTTTGGAGGGACACTGG - Intergenic
1140019064 16:71219597-71219619 GAGGTGGTATGGAGGAAAAGTGG - Intronic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141370878 16:83485330-83485352 CAGCTGATATAAAGGGAAACTGG - Intronic
1142490581 17:276076-276098 CAGTTGGTACAGAGGAAATCGGG + Intronic
1142730186 17:1849120-1849142 CTGTTGGCAGGGAGGTAAACTGG - Intronic
1145785110 17:27588495-27588517 CAGATGGTACGGAGGGATATCGG + Exonic
1146906538 17:36621747-36621769 CAGGTGGCATGGAGGGCAAGGGG + Intergenic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1154305977 18:13231197-13231219 CAGGTGGTATGGGAGGAAGCGGG + Intronic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1157051677 18:44173406-44173428 CAGTTGGTGTTGAAGGAATCTGG - Intergenic
1159320212 18:66838561-66838583 CACTTGCTCTGGAGTGAAACAGG + Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1164430818 19:28187187-28187209 GAGTTGATAGGGAGGGAAAGGGG - Intergenic
1165584804 19:36904869-36904891 AAGTTGGTAGGGAGGAAAAGTGG + Intronic
1166095041 19:40533053-40533075 CAAATGGTATGGAAGGAACCTGG - Intronic
1166137404 19:40786033-40786055 CAGTTGGGATGAGGGGACACAGG + Intronic
1166697644 19:44862684-44862706 AAGGTGGGAGGGAGGGAAACAGG + Intronic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
927211964 2:20644615-20644637 CACTTGGTATGGAAGGGAAAGGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928229975 2:29489835-29489857 CAGGTGTTATGAAGGGAAAGTGG + Intronic
930950690 2:57140796-57140818 GGGTTGGTAGGGAGGAAAACGGG - Intergenic
934518409 2:95004037-95004059 CTGTTATTATGGAGGGGAACAGG + Intergenic
935524825 2:104152801-104152823 AAGGTGGTATGAAGGAAAACAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
938341150 2:130537526-130537548 CAGTTGCTATCCAGGGAAATGGG - Intergenic
938348680 2:130583183-130583205 CAGTTGCTATCCAGGGAAATGGG + Intronic
938806639 2:134812391-134812413 ATTTTGGCATGGAGGGAAACTGG - Intergenic
939513401 2:143135728-143135750 CAGGTAGTTTGGAGGAAAACTGG - Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
944650761 2:201828130-201828152 AAGTTGGTTTGGAGAGAAAGAGG + Intronic
944982120 2:205133417-205133439 CAGTAGGTGTGGAGGGAGCCTGG - Intronic
948693436 2:239720970-239720992 CAGGAGGTTTGGAGGGGAACTGG + Intergenic
1170731578 20:18980536-18980558 CAGTTGGTAAGTAGGGGCACTGG + Intergenic
1171038773 20:21740321-21740343 CAGTTAGCATTGAGGGAAAGTGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173207240 20:41004712-41004734 CAGGTGATAGGCAGGGAAACAGG + Intergenic
1173458252 20:43221154-43221176 CAGTTGGTAAGCAGGGGCACTGG - Intergenic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1178440595 21:32595003-32595025 CAGTTGGTATGAAGAGTAAATGG + Intronic
949456927 3:4248837-4248859 CATGTGGTATGGAGGAAAACCGG + Intronic
950007632 3:9701705-9701727 CAGGTGGTATGGAGGGAGGGAGG + Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950752826 3:15144366-15144388 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
953079490 3:39602544-39602566 TAGTTAGGATGTAGGGAAACTGG - Intergenic
953696649 3:45165158-45165180 CAGTTTATATGTAAGGAAACAGG - Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
958073559 3:88646913-88646935 AAGATGGGATGGAGGGAAAGGGG + Intergenic
958736211 3:98012032-98012054 GAGTTGGTGAGGAGGAAAACAGG + Intronic
958743194 3:98099676-98099698 CAATGGGTCTGGAGAGAAACTGG + Intergenic
959615515 3:108342897-108342919 CAGGTGCTGTGGAAGGAAACAGG - Intronic
960246919 3:115409907-115409929 CACTTGTAATTGAGGGAAACGGG + Intergenic
961285369 3:125798083-125798105 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
964620975 3:158719739-158719761 CAATCAGTTTGGAGGGAAACAGG + Intronic
964761456 3:160138265-160138287 CTGTTTGAATGGAGGGTAACTGG + Intergenic
964852351 3:161108441-161108463 CATTTGGCAGGTAGGGAAACTGG + Intronic
965941769 3:174192809-174192831 AAGTTGCTAGGGAGGGAAATTGG - Intronic
966869972 3:184284031-184284053 GAGATGGCATGGAGGGAAGCTGG - Intronic
967646329 3:191928484-191928506 CAGGTGGTATGGAGAGATAATGG + Intergenic
968835080 4:2957589-2957611 CAGCAGGTATGGAAAGAAACTGG - Exonic
969345497 4:6567344-6567366 TAGCTGGAATGGAGGGAACCAGG - Intergenic
969483667 4:7459889-7459911 CAATTGGTAGGGAGGGAGAGAGG + Intronic
969741732 4:9033264-9033286 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969801098 4:9566161-9566183 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
976494909 4:85716878-85716900 CAGCTAGCATGGAAGGAAACAGG + Intronic
977989771 4:103427000-103427022 CAGTTTATGTGGAGGGAAGCAGG + Intergenic
978000704 4:103554276-103554298 CAGGTGGTATGGAGAGAGAATGG + Intergenic
983273950 4:165595004-165595026 CAGTTGGTATGTACTGAAATAGG + Intergenic
985367291 4:189245297-189245319 CCGTTGATATGCAGGCAAACAGG - Intergenic
986170709 5:5312208-5312230 CATCTGGTTTGGAGGTAAACAGG - Intronic
989658866 5:43776696-43776718 TAGCTGGGGTGGAGGGAAACTGG - Intergenic
989748820 5:44866190-44866212 CAGATGGTGAGGAGGGAAAGAGG - Intergenic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
995054334 5:107742702-107742724 AAGTTGACTTGGAGGGAAACAGG + Intergenic
995977074 5:118051955-118051977 CAGTTGGTAGGTTGGTAAACTGG + Intergenic
996405388 5:123098544-123098566 CAGTTCGAGTGGAGGGATACTGG + Intronic
996836897 5:127803684-127803706 CCGTTGGGATGGAGGTAAAGAGG - Intergenic
1003912106 6:10752275-10752297 GTGTTGGAAAGGAGGGAAACAGG - Intronic
1005220246 6:23578511-23578533 CAGATGTTATGGAGGTAAAGCGG + Intergenic
1006517254 6:34551898-34551920 TAGTTGCTATGGTGGGAAACTGG - Intronic
1006604887 6:35249063-35249085 AAGTGGGTCTGGTGGGAAACGGG + Exonic
1007155113 6:39735296-39735318 CAGTTTGATTGGAGGGAAAGGGG - Intergenic
1009359777 6:62796947-62796969 CAGGTGGTATGGAGAGATAATGG - Intergenic
1013105981 6:107027182-107027204 TAGTTGGTTGGGAGGGAAAGGGG + Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1016219264 6:141646643-141646665 CAGCTGGGATGGAGGGCACCAGG - Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016994316 6:149951049-149951071 GATTTGCTATGGAGGGAGACAGG + Intergenic
1017419757 6:154261437-154261459 CAATTGGATTGGAGGGACACAGG + Intronic
1017852674 6:158318583-158318605 CAGCTTGTATGGAGGAGAACTGG + Intronic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1023229446 7:38010248-38010270 CAGTTGGTAGGAATGTAAACTGG - Intronic
1024569456 7:50711652-50711674 CAGTTGGTAGAGAGGGTATCAGG - Intronic
1024791472 7:52969481-52969503 CAGTTGGGATAGAGGGGATCTGG - Intergenic
1028582959 7:92425561-92425583 GAGTTGGAATGCAGGGAAACTGG + Intergenic
1028960622 7:96745792-96745814 CTGCTGGTAGGGATGGAAACAGG + Intergenic
1029496532 7:100897881-100897903 CAGTTCGTCTGGAGGGTGACAGG - Intergenic
1032794586 7:135267598-135267620 CAGCTGGGAAGGAAGGAAACTGG - Intergenic
1032945882 7:136851901-136851923 GAGCTGGTATGGAGGGAGAGGGG + Intergenic
1035087727 7:156275630-156275652 CAGTTAATATGTGGGGAAACTGG - Intergenic
1036246924 8:7125861-7125883 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036253879 8:7188549-7188571 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036363614 8:8098930-8098952 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036887341 8:12568139-12568161 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036894935 8:12626240-12626262 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038832244 8:31074283-31074305 CAGTTGGTTTGGGAGGAAATGGG + Intronic
1041041935 8:53855666-53855688 CAGTCTCTATTGAGGGAAACTGG + Intronic
1057220605 9:93255904-93255926 CAGACGATATGGAGAGAAACGGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059693518 9:116709095-116709117 CAGCTGGTATGGAGAGTCACAGG - Intronic
1062170651 9:135133028-135133050 CAGTTTGAAGGGTGGGAAACCGG + Intergenic
1203785640 EBV:126073-126095 CAGTTGGGGAGGAGGGGAACTGG - Intergenic
1189014493 X:37082496-37082518 CAGTTGTCATGCAGGCAAACAGG - Intergenic
1190607454 X:52159851-52159873 CTGTTGGTAAGGATGTAAACTGG + Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191731530 X:64340905-64340927 CTGTTGGTAGGAATGGAAACTGG + Intronic
1193214664 X:78849529-78849551 GAGTTGGAATGGAGAGAAAATGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196115131 X:111991163-111991185 CAATTGGTATAGAGGGGAAAGGG - Intronic
1196495804 X:116324110-116324132 CAGTTGGTCTGGGGGAGAACAGG - Intergenic
1197844123 X:130783016-130783038 TAGTGGGTATTGAGGGGAACAGG + Intronic
1197864402 X:131002537-131002559 CAGATGGTATGGAGGAGCACTGG + Intergenic