ID: 904624366

View in Genome Browser
Species Human (GRCh38)
Location 1:31793746-31793768
Sequence CTCCCACGGAACCACAGGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904624366_904624372 5 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624372 1:31793774-31793796 TCCCTGGTTTTGGGCATCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 251
904624366_904624377 24 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624377 1:31793793-31793815 CTGGAGCAGGCATAGGAGTTTGG 0: 1
1: 0
2: 0
3: 28
4: 304
904624366_904624370 -5 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624370 1:31793764-31793786 GGGAGACAACTCCCTGGTTTTGG 0: 1
1: 0
2: 0
3: 6
4: 105
904624366_904624376 17 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624376 1:31793786-31793808 GGCATCTCTGGAGCAGGCATAGG 0: 1
1: 1
2: 2
3: 27
4: 250
904624366_904624378 30 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624378 1:31793799-31793821 CAGGCATAGGAGTTTGGCTTAGG 0: 1
1: 0
2: 1
3: 14
4: 191
904624366_904624371 -4 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624371 1:31793765-31793787 GGAGACAACTCCCTGGTTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 136
904624366_904624375 11 Left 904624366 1:31793746-31793768 CCTGTCCTGTGGTTCCGTGGGAG 0: 1
1: 0
2: 5
3: 19
4: 134
Right 904624375 1:31793780-31793802 GTTTTGGGCATCTCTGGAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904624366 Original CRISPR CTCCCACGGAACCACAGGAC AGG (reversed) Exonic
901187412 1:7384015-7384037 TTCCCACTGAAACACAGGACGGG + Intronic
902577767 1:17389202-17389224 CTCCTACGGAGCCAGAGAACAGG + Intronic
903122497 1:21225435-21225457 CTCCCTCTGACCCACAGGACGGG - Exonic
904051939 1:27645203-27645225 GACCCATGGAGCCACAGGACAGG + Intergenic
904372023 1:30054426-30054448 CTTCCAGGGAACCACCAGACAGG - Intergenic
904624366 1:31793746-31793768 CTCCCACGGAACCACAGGACAGG - Exonic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
906715999 1:47969773-47969795 CTCCCTCTGAACCCCAGGGCTGG - Intronic
912757624 1:112337461-112337483 CTCCCACGGAACCTGAGGGCTGG + Intergenic
915644788 1:157261970-157261992 CTTCCAAGGTACCACAAGACAGG + Intergenic
922332115 1:224586543-224586565 CTCCCAGGGAAGCAAAGTACTGG - Intronic
1062880500 10:974266-974288 CTCCCACGGAAACCCAGGGCGGG + Intergenic
1062916225 10:1242760-1242782 CTAACACAGAAACACAGGACAGG + Intronic
1063142831 10:3270863-3270885 CTCTCATGGAATCACAGGCCAGG - Intergenic
1063161189 10:3420211-3420233 CTTCCACGGAGGCTCAGGACTGG + Intergenic
1063248857 10:4252282-4252304 CTCACATGTAACTACAGGACTGG - Intergenic
1069683846 10:70304228-70304250 CTCCCACCCTAGCACAGGACGGG + Intronic
1073485923 10:103819266-103819288 TTCCCAGGGAACCCCAGGAGAGG + Intronic
1074508655 10:114093881-114093903 CTCAGACAGAACCACAGCACTGG - Intergenic
1076681177 10:132172205-132172227 TCTCCACGGAACCACAGGCCAGG - Intronic
1077580688 11:3415246-3415268 CTCCCATGGCATCACAGGCCTGG - Intergenic
1079908484 11:26279687-26279709 CTCCCAGGGAACCAGAAAACTGG + Intergenic
1083005628 11:59343172-59343194 ATCCCACCGTACCTCAGGACAGG + Intergenic
1084237616 11:67798075-67798097 CTCCCACGGCATCACAGGCCTGG - Intergenic
1084677230 11:70642595-70642617 CTCCCACGGACACAGAGGCCGGG + Intronic
1084834787 11:71794753-71794775 CTCCCACGGCATCACAGTCCTGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088851702 11:113708590-113708612 CTTCCAGGGAACCACTAGACAGG - Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1091103249 11:132895431-132895453 CTCCCATGTAGCCACAGGTCTGG + Intronic
1091123135 11:133073447-133073469 CAACCACGGAAACCCAGGACAGG + Intronic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1094733479 12:33205271-33205293 CTCCCACGTAACCAGATGAAAGG + Intergenic
1096001127 12:48131479-48131501 TTCCCATGAAACCACATGACAGG - Intronic
1098358741 12:69634999-69635021 CTCCCACTGAACCAAAGGCAGGG - Intergenic
1101789091 12:107911799-107911821 CTCCCTCGCATCCACAGTACTGG - Intergenic
1102716297 12:114975878-114975900 CCACCAGTGAACCACAGGACTGG - Intergenic
1103328493 12:120137575-120137597 CTCCTCCAGAACCACAGGGCTGG + Exonic
1105923664 13:24987211-24987233 CTCCCACTGAGACACAGGAGGGG + Intergenic
1107418764 13:40225706-40225728 CACCCACGGAACCAGAAGGCAGG + Intergenic
1108015049 13:46065754-46065776 TTGCCACGGAACCACAGGCCTGG - Intronic
1112290670 13:98142595-98142617 CTCCCCCGGAGCCACAGGCACGG - Exonic
1112462003 13:99610989-99611011 CTTCCAAGGAACCACAAGACAGG + Intronic
1112988573 13:105482404-105482426 CTCCCACGGAAGCTAAGGGCAGG - Intronic
1114032837 14:18590750-18590772 CCCCCCAGGTACCACAGGACAGG + Intergenic
1114077626 14:19169798-19169820 CCCCCCAGGTACCACAGGACAGG + Intergenic
1114511774 14:23268199-23268221 CTTCCAGGGAACCACTAGACAGG + Intronic
1115873100 14:37828072-37828094 CTGCCATGGGACCACTGGACTGG + Intronic
1122118941 14:99541617-99541639 CTCCCAGTGAACCATTGGACAGG - Intronic
1122248925 14:100424602-100424624 TTCCCACGCAAACACTGGACAGG - Intronic
1122529872 14:102418079-102418101 CTCCCACGCAGCCACCTGACAGG - Intronic
1123907930 15:24938718-24938740 CTCCAAGGGAAACACAGGGCAGG + Intronic
1126535416 15:49756809-49756831 CTTCCATGGAACCACCAGACAGG - Intergenic
1128041828 15:64581564-64581586 CTTCCAGGGAACCACCGGAAAGG + Intronic
1129122530 15:73409621-73409643 CTCCAACAGAACCACAGGAAAGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1132201224 15:99956091-99956113 TTCCCATGGAACCACAGTAGAGG - Intergenic
1133349245 16:5090499-5090521 CTCCTACGGTACCACAGGCCTGG - Exonic
1133695456 16:8258557-8258579 CTCCTACAGAACCAAAGGATGGG + Intergenic
1138415624 16:56869920-56869942 CTCTCCCGGAACCACAGGAGCGG - Intronic
1140940881 16:79720863-79720885 CTCCTAGGGAACACCAGGACAGG - Intergenic
1141592871 16:85080164-85080186 TTCCCATGGAAGCAGAGGACGGG + Intronic
1141897094 16:86965068-86965090 CTCCCCCGGAGCCCCAGGAAGGG - Intergenic
1145895349 17:28454289-28454311 CTCCCAGGGAACTTCAGGATAGG - Intergenic
1146138585 17:30344901-30344923 CTCCCGCTGAACCACAGGGTTGG - Intergenic
1147653220 17:42073609-42073631 CTCCCAGGGAATCAAAGCACAGG + Intergenic
1149996211 17:61407268-61407290 CTCCCAGGGAGCCTCAGGCCTGG - Intronic
1152230459 17:79111767-79111789 CTCCCAAGGGCCCACAGTACTGG + Intronic
1152884991 17:82844518-82844540 CTCCCCCTGATCCACAGGACAGG - Intronic
1152927431 17:83093748-83093770 CTTCCACGGCACCACACGACGGG - Intronic
1157836386 18:50907165-50907187 CTTCCAGGGAACCACCAGACAGG + Intronic
1160061800 18:75535531-75535553 CTGCCACGGAATCACAGAACAGG + Intergenic
1162132650 19:8536641-8536663 CTCCCACCCACCCCCAGGACTGG - Intronic
1162851748 19:13436382-13436404 CTGCTACAGAACAACAGGACTGG + Intronic
1163534342 19:17868622-17868644 CTCCCAGGGAACCAAGGGGCAGG + Intergenic
1163760314 19:19132895-19132917 CCCCCACCCACCCACAGGACTGG + Intronic
1164911741 19:32018264-32018286 CACCTACGTAACCACAGGAAGGG - Intergenic
1165327806 19:35124485-35124507 CTCCCAAGGATCCACAACACTGG + Intergenic
934090575 2:88547169-88547191 CTCTCACGGGACCTCAGAACTGG - Intergenic
937011860 2:118570018-118570040 GTCCCATGGATCCACAGCACAGG - Intergenic
942395791 2:175548122-175548144 CTTCCAGGGAACCACAAGAAAGG + Intergenic
943321115 2:186444256-186444278 CTCCCAGTGAACCTCAGCACTGG + Intergenic
946162507 2:217844358-217844380 CCCCCATGAAACCACAGGAATGG + Intronic
946245865 2:218387087-218387109 CTCCTACGGAGCCTCAGGGCTGG - Intronic
947045725 2:225981053-225981075 TTTCCAGGGAACCACAAGACAGG - Intergenic
947876317 2:233470346-233470368 CTCCCTGGGAACCACAGAATGGG - Exonic
1169584838 20:7069623-7069645 CTCCCAAGAAACTAAAGGACAGG + Intergenic
1171988212 20:31675601-31675623 CCCCCACGGAAACATAGGCCTGG + Intronic
1174147207 20:48460204-48460226 CTCCCACAGACACACAGCACAGG + Intergenic
1175176780 20:57117352-57117374 CTCCCACAGGACAACAGGGCGGG + Intergenic
1175821984 20:61914972-61914994 CTCCCAGGGAGCCTCAGGCCAGG + Intronic
1176030241 20:63008119-63008141 CTGGCAGGGAACCACCGGACAGG - Intergenic
1176615820 21:9027604-9027626 CCCCCCAGGTACCACAGGACAGG - Intergenic
1176709339 21:10136130-10136152 CCCCCCAGGTACCACAGGACAGG + Intergenic
1178176212 21:30102518-30102540 CTCCCACTCAACCTCAGGGCTGG + Intergenic
1180456953 22:15517807-15517829 CCCCCCAGGTACCACAGGACAGG + Intergenic
1180963835 22:19775634-19775656 CACGCTCGGAACCACAGGTCCGG + Intronic
1184890857 22:47378297-47378319 CTGCCACGGAAACAAAGGAAAGG - Intergenic
951016970 3:17742357-17742379 CTCCCACTCAGCCTCAGGACAGG - Intronic
955788053 3:62560625-62560647 TTCTCATGGAATCACAGGACAGG + Intronic
957053570 3:75427842-75427864 CTCCCATGGTACCACAGGCCTGG - Intergenic
961887238 3:130104233-130104255 CTCCCACGGTACCACAGGCCTGG - Intronic
962506288 3:136049608-136049630 CTCCCACTGAAGCAGAGGAGAGG + Intronic
968996363 4:3948154-3948176 CTCCCACGGCACCACAGGCCTGG - Intergenic
969045466 4:4333454-4333476 CTCCGGCCAAACCACAGGACTGG + Intergenic
969538423 4:7770744-7770766 CTCAAACAGAACCAGAGGACGGG + Intronic
969757623 4:9160534-9160556 CTCCCATGGTACTACAGGCCTGG + Intergenic
969817603 4:9698065-9698087 CTCCCACGGCACCACAGGCCTGG + Intergenic
971804778 4:31341774-31341796 CTCCCAGGGAACCACCAGCCAGG - Intergenic
976658739 4:87517020-87517042 CTCCCACTATAACACAGGACAGG - Intronic
981116097 4:140992976-140992998 CTCCCCAGGATCCACAGGAGAGG + Intronic
981748836 4:148074514-148074536 CTTCCACAGAGCCACAGGAGGGG - Intergenic
986201666 5:5584820-5584842 AGCCCACGGCACCAGAGGACAGG - Intergenic
986928788 5:12794011-12794033 CTCACAGGTAACCACAGGGCAGG + Intergenic
992228816 5:74643498-74643520 CTCCCAAGGGCCTACAGGACTGG - Intronic
992473549 5:77080782-77080804 CTCCCACGCCACCCCACGACAGG - Intronic
997257110 5:132437703-132437725 CTCCCAGGGACTCCCAGGACTGG - Intronic
1000259382 5:159572102-159572124 CTTCCAGGGAACCACCAGACAGG + Intergenic
1002480474 5:179497750-179497772 CTCCCAAGGAGCTACAGGTCAGG + Intergenic
1003400552 6:5786991-5787013 CTCCCACTGAGACACAGGAGGGG + Intergenic
1003506848 6:6746692-6746714 CTCCCACAGAACCACAAAAAGGG - Intergenic
1006297381 6:33175888-33175910 CTCCCAAGGGAACACAGCACTGG + Intronic
1019151043 6:170006100-170006122 CTCCCACAGACCCACAGGGTGGG - Intergenic
1020320641 7:6936568-6936590 CTCCCACGGCATCACAGGCCTGG - Intergenic
1022092324 7:27115699-27115721 CTCCCACGGCTCCTCAGGTCTGG - Intronic
1027774315 7:82444527-82444549 GTCCAATGGAACCACAGGGCTGG - Intergenic
1034359646 7:150483066-150483088 CTCCCAGGGCACCACTGGACAGG - Intergenic
1034379261 7:150675835-150675857 CTCCCAGGGCACCACTAGACAGG - Intergenic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1036577826 8:10045015-10045037 CTCCCCTGGAACTAAAGGACTGG + Intergenic
1036848699 8:12186767-12186789 CTCCCACGGTACCACAGGCCTGG - Exonic
1036870060 8:12429048-12429070 CTCCCACGGTACCACAGGCCTGG - Exonic
1037135526 8:15455225-15455247 CTCCCCCAAAACCCCAGGACTGG + Intronic
1038980320 8:32752323-32752345 CTCCCCCATAGCCACAGGACAGG - Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1041577981 8:59421480-59421502 CTCCCACTGACCCAGATGACTGG - Intergenic
1041656413 8:60355183-60355205 CTTCCAGGGAACCACTGGACAGG - Intergenic
1049220974 8:141428646-141428668 CTCGCACAGACCCACAGGGCGGG - Intronic
1051735138 9:20190062-20190084 CTCCCAGGGAACCGCTGGAGAGG - Intergenic
1052969737 9:34370204-34370226 CTCCCAGGGAACAGGAGGACTGG - Exonic
1053646308 9:40121666-40121688 CCCCCCAGGTACCACAGGACAGG + Intergenic
1053759406 9:41341885-41341907 CCCCCCAGGTACCACAGGACAGG - Intergenic
1054327320 9:63719568-63719590 CCCCCCAGGTACCACAGGACAGG + Intergenic
1054538260 9:66254307-66254329 CCCCCCAGGTACCACAGGACAGG - Intergenic
1060250971 9:121986568-121986590 CTCCCTGGGAACCAAAGGCCAGG + Intronic
1061176685 9:129001877-129001899 CTCCCAGGGAGCCACAGCAGTGG + Exonic
1061368366 9:130184299-130184321 CTCTCAGGGACCCACAGGCCTGG + Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1062287875 9:135781170-135781192 CTGCCACGGAATCGCATGACTGG - Intronic
1202794098 9_KI270719v1_random:105097-105119 CCCCCCAGGTACCACAGGACAGG + Intergenic
1186785936 X:12955970-12955992 CTCTCAGGGAACCACAAGCCAGG + Intergenic
1187986057 X:24812402-24812424 ATCCCATGCAACCAAAGGACAGG - Intronic
1188886147 X:35551972-35551994 CTCCAATGGAACCACAGAGCAGG - Intergenic
1190893001 X:54587187-54587209 CTCCCATGGAGCCCAAGGACAGG + Intergenic
1191841901 X:65519239-65519261 CTCCCACGGCTCCTCAGCACAGG - Intronic
1191859784 X:65656852-65656874 CTCCCACGGCTCCTCAGCACAGG - Intronic
1193168497 X:78308893-78308915 CTCCCAGGGAAACACAGATCAGG - Intronic
1197295182 X:124710233-124710255 CTCCAAAGTAACCACAGGGCAGG - Intronic
1197992564 X:132333838-132333860 CTTCCCTGGAACCACAGTACAGG + Intergenic