ID: 904624426

View in Genome Browser
Species Human (GRCh38)
Location 1:31794050-31794072
Sequence GCGTGCAGTTCAGCAGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904624426_904624427 -8 Left 904624426 1:31794050-31794072 CCTGTTGCTGCTGAACTGCACGC 0: 1
1: 0
2: 1
3: 3
4: 92
Right 904624427 1:31794065-31794087 CTGCACGCTCAGCCCCAGCCTGG 0: 1
1: 0
2: 3
3: 47
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904624426 Original CRISPR GCGTGCAGTTCAGCAGCAAC AGG (reversed) Intronic
900372624 1:2338956-2338978 GCTTTCAGTTCAGCAGGAAGAGG + Intronic
901791559 1:11655907-11655929 GGCGGCAGTTCAGCAGCAGCTGG - Exonic
901793792 1:11668751-11668773 GGCGGCAGTTCAGCAGCAGCTGG - Exonic
901932900 1:12608336-12608358 GCATCCAGTTCAGAAGCCACAGG + Intronic
904624426 1:31794050-31794072 GCGTGCAGTTCAGCAGCAACAGG - Intronic
913216898 1:116628326-116628348 GTGGGGAGTGCAGCAGCAACAGG - Intronic
915310078 1:155002246-155002268 GCGGGCAGAGCAGCAGCAAAGGG + Intergenic
915342589 1:155184589-155184611 GGCTGTAGTTCAGCATCAACAGG - Exonic
916208143 1:162335320-162335342 ACCTACAGCTCAGCAGCAACAGG - Intronic
918377048 1:183919830-183919852 GCATTCAGTACAGCAGCCACTGG + Intronic
918621034 1:186606109-186606131 AAGAGCAGTTCAGCAGCACCGGG - Intergenic
923566999 1:235083744-235083766 GGGAGCAGAGCAGCAGCAACAGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063664044 10:8051334-8051356 GCGTGCGGGTCGGCAGCAGCCGG - Intergenic
1066360821 10:34729032-34729054 GTTTGCAGTCCAGGAGCAACAGG + Intronic
1069877566 10:71572461-71572483 GCGTGCAGTTCAGCAGGGACAGG + Intronic
1070600047 10:77859587-77859609 GTTTGCAGCTCAGGAGCAACAGG + Intronic
1071582977 10:86790821-86790843 GTGTGCAGTTCAGTAGCTATCGG - Intronic
1075521094 10:123143898-123143920 GCGTGCACTCCATCACCAACGGG - Intergenic
1075733695 10:124651476-124651498 GCCTGCAGTTCAGCAGTGAGGGG - Intronic
1076992825 11:284598-284620 GTGTGCAGTCCTGCAGCACCAGG + Exonic
1083951926 11:65961407-65961429 GCTTGCACTTCACCGGCAACGGG - Intergenic
1084007468 11:66331020-66331042 CCTTGCAGTCCAGCAGCATCAGG - Intronic
1090874451 11:130776382-130776404 TGGTGCAGTTCAGAAGCAATGGG + Intergenic
1091846492 12:3660022-3660044 GCGTGGAGATCAGCGGGAACAGG - Intronic
1096431917 12:51551823-51551845 GCGTGTATTTCAGCAGCAAATGG + Intergenic
1103715009 12:122940149-122940171 GCTTGCCGTCCAGCAGCACCCGG + Exonic
1105989209 13:25601681-25601703 GAGTTCAGTTCGACAGCAACTGG - Intronic
1109836205 13:67860533-67860555 GCCTGCACTTCAGGAGCAGCTGG + Intergenic
1110719971 13:78750133-78750155 GTCTGCAGCTTAGCAGCAACAGG - Intergenic
1113707684 13:112445099-112445121 GCGTCCTTTTCAGCAGCAACAGG - Intergenic
1113840351 13:113355790-113355812 CCGTGCAGAGCAGCAGCAAAGGG + Intronic
1115640011 14:35329382-35329404 GGGTGCAGAGCAGCAGTAACTGG + Intergenic
1119729576 14:76942448-76942470 GACTGCAGCTCAGCACCAACAGG - Intergenic
1126535401 15:49756723-49756745 GCCAGCAGTCCAGCAGCCACTGG + Intergenic
1131290384 15:91101659-91101681 GCGTGGATTTCAGCAGGGACTGG + Intronic
1132219551 15:100095090-100095112 CTGTCCAGTTCAGCAGCCACTGG - Intronic
1136289800 16:29264741-29264763 CCATGCAGTTCAGCAGACACAGG - Intergenic
1137720380 16:50624242-50624264 GCATGCTGTTCAGCAGGAAAGGG - Intronic
1138114232 16:54347715-54347737 GCTTGCAGTGCAGAAGCAGCAGG + Intergenic
1142095684 16:88238217-88238239 CCATGCAGTTCAGCAGACACAGG - Intergenic
1144523294 17:15968694-15968716 GACTGCAGTTTAGCAGCAGCAGG + Intronic
1144947273 17:18976362-18976384 GCTTGCAGTTCAGTAGCAGAGGG - Intronic
1146465089 17:33080015-33080037 GCGAGGAGTTCAGCAGCCCCTGG + Intronic
1147228984 17:39003366-39003388 GCCTGCAATCCAGCAGCAATAGG - Intergenic
1147427728 17:40354298-40354320 GCGTGCAGATCCGCAGGATCTGG - Exonic
1147492181 17:40879917-40879939 GACTGCAGTTCTGCAGCAACAGG - Exonic
1151540471 17:74762214-74762236 CCCTGCAGATCAGCAGCACCTGG + Intronic
1152477487 17:80527509-80527531 GCCTGGAGTTCAGCAGCGTCAGG + Intergenic
1156181636 18:34612044-34612066 GGCTGCAGTTGAGCAGCAAGTGG - Intronic
925194462 2:1912034-1912056 GCGGGCATGTCAACAGCAACAGG - Exonic
931338246 2:61371929-61371951 GCTTGGAGTCAAGCAGCAACAGG + Intronic
932589917 2:73059122-73059144 TCCTGCACTTCAGCAGCTACAGG - Intronic
936965718 2:118125916-118125938 GAGTGCAGTTCTGTAGTAACAGG - Intergenic
937326066 2:120990072-120990094 ACGTGCTGTGCAGCAGCAGCTGG + Exonic
939651386 2:144766950-144766972 GGAAGCAGTTCAGCAGAAACTGG + Intergenic
939957691 2:148540294-148540316 GCGTGCAGTGCAGGGGGAACAGG + Intergenic
944469628 2:200039084-200039106 GCCTTCTGTTCAGCAGCAAGGGG - Intergenic
1172969175 20:38861106-38861128 ACATGCAGTTCAGAAGCAGCTGG + Intronic
1180924945 22:19547185-19547207 GTATGCAGTTCAGTAGCAATAGG + Intergenic
1181498187 22:23300057-23300079 GTGTGCAGTTCAGTGGCATCAGG + Intronic
1183795603 22:40114648-40114670 GCTTGCAGTTTAGCAGGACCTGG + Intronic
951162437 3:19441092-19441114 GCGGGCACCTCAGCAGCAGCAGG + Intronic
956483064 3:69692067-69692089 GCTTGAAGATCAGCAACAACAGG + Intergenic
959901696 3:111669017-111669039 GCCTGTAGATCACCAGCAACAGG - Intergenic
960796013 3:121488789-121488811 GGGTGCTGTTCAGCAGGAAAAGG + Exonic
961461149 3:127051153-127051175 GCTTGCAGATCCGCAGCAAGGGG + Intergenic
964410578 3:156393409-156393431 GGTGGCATTTCAGCAGCAACTGG - Intronic
967411849 3:189174188-189174210 GCTTGCAGAGCAGCAGCCACAGG + Intronic
967929871 3:194683197-194683219 CCGGGCTGTTCAGCAGCAGCCGG - Intergenic
967961689 3:194930566-194930588 GCCTGCATTTCAACAGCCACTGG + Intergenic
974772783 4:66437250-66437272 GCCTGCAGTTCTACAGCACCAGG - Intergenic
976285861 4:83370594-83370616 GAGGGCAGTTCTCCAGCAACAGG - Intergenic
980236139 4:130109145-130109167 CCATCCAGTTCAGCAGCAAAGGG - Intergenic
985776519 5:1846997-1847019 GCGTTCTCTTCTGCAGCAACAGG + Intergenic
986165694 5:5269883-5269905 AGGTGCAGTTCAGCAGCAGAGGG + Intronic
990618873 5:57538563-57538585 GCCTGCAGAGCTGCAGCAACTGG - Intergenic
991528358 5:67588919-67588941 GGGTTCAATTAAGCAGCAACTGG + Intergenic
994089018 5:95792102-95792124 GCAGGCAGGGCAGCAGCAACAGG + Intronic
994095333 5:95842630-95842652 GGCTGCAGTTCAGCAGCATGCGG + Intergenic
1013771450 6:113632493-113632515 ACGTGCACTGCAGCAGCACCGGG - Intergenic
1014565026 6:122938228-122938250 GCATCCAGTTCAGGAGCAAAAGG - Intergenic
1021933935 7:25611160-25611182 CTGTGCTGTTCAGTAGCAACTGG - Intergenic
1022662622 7:32380893-32380915 GTGTGCAGTACAGCTGCAAATGG - Intergenic
1022802547 7:33790078-33790100 ACGTGCTGTTCAGACGCAACTGG + Intergenic
1023184002 7:37514652-37514674 GCGTGCAGTGCAGCAAGAAGGGG - Intergenic
1024983954 7:55180069-55180091 CCGGGCAGGTCAGGAGCAACAGG - Intronic
1026360103 7:69596189-69596211 GCGTGGATTTCAGCAGCTGCCGG + Intergenic
1028890342 7:95980205-95980227 GCATACAGTGCAGCAGGAACAGG - Intronic
1029150170 7:98474739-98474761 GTTTGCAGTTTAGGAGCAACAGG - Intergenic
1032497549 7:132374071-132374093 TCGTGCAGGTCAGCATCAAATGG - Intronic
1036390308 8:8318903-8318925 GGGTGCAGTGCACCAGCAGCAGG + Exonic
1039672127 8:39613056-39613078 GCATGCATGGCAGCAGCAACAGG - Intronic
1044772794 8:95654939-95654961 GAGTGAAGTTCAGAAGAAACTGG + Intergenic
1059295713 9:113268592-113268614 GCCCACAGTTCAGCAGCAAGTGG - Intronic
1060533811 9:124366852-124366874 GCTTGCAGCCCAGGAGCAACAGG + Intronic
1197309606 X:124888216-124888238 GTATGCAGTACAGAAGCAACAGG + Intronic