ID: 904625461

View in Genome Browser
Species Human (GRCh38)
Location 1:31799656-31799678
Sequence CTCCCCAAAGGGGTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 406}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904625461_904625477 23 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625477 1:31799702-31799724 GGGAGAGAAGAATCATAGCAGGG 0: 1
1: 0
2: 3
3: 23
4: 292
904625461_904625476 22 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625476 1:31799701-31799723 GGGGAGAGAAGAATCATAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 244
904625461_904625471 -6 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625471 1:31799673-31799695 GGGGAGGAGCTATAGGCTGATGG 0: 1
1: 0
2: 1
3: 29
4: 273
904625461_904625479 28 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625479 1:31799707-31799729 AGAAGAATCATAGCAGGGGCTGG 0: 1
1: 0
2: 5
3: 14
4: 266
904625461_904625474 2 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625474 1:31799681-31799703 GCTATAGGCTGATGGGATGTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
904625461_904625475 3 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625475 1:31799682-31799704 CTATAGGCTGATGGGATGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 138
904625461_904625473 1 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625473 1:31799680-31799702 AGCTATAGGCTGATGGGATGTGG 0: 1
1: 0
2: 0
3: 9
4: 159
904625461_904625480 29 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625480 1:31799708-31799730 GAAGAATCATAGCAGGGGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 228
904625461_904625472 -5 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625472 1:31799674-31799696 GGGAGGAGCTATAGGCTGATGGG 0: 1
1: 0
2: 0
3: 17
4: 201
904625461_904625478 24 Left 904625461 1:31799656-31799678 CCTTCCCCCACCCCTTTGGGGAG 0: 1
1: 0
2: 3
3: 38
4: 406
Right 904625478 1:31799703-31799725 GGAGAGAAGAATCATAGCAGGGG 0: 1
1: 0
2: 1
3: 34
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904625461 Original CRISPR CTCCCCAAAGGGGTGGGGGA AGG (reversed) Intronic
900175749 1:1290699-1290721 GTCCCCAAAGTGGTGGGGTGGGG + Intronic
900299077 1:1967782-1967804 TTCCCTAAAGGTGTGGGGTAGGG - Intronic
900537807 1:3187420-3187442 ATCCCCAGACGGGTGGGGGCAGG + Intronic
900689991 1:3974709-3974731 CTCCCCTCAGGGGTGTGAGATGG + Intergenic
901629333 1:10640667-10640689 CTACCCCAAGGGCTGGGAGAGGG + Intronic
901707840 1:11089706-11089728 CCTCCCAAAGGGTTGGGGGTTGG - Intronic
902612026 1:17603084-17603106 CTCCCATCAGGGGTGGGGGCTGG + Intronic
902660212 1:17895717-17895739 TTCCCCAAAGGAGAAGGGGATGG + Intergenic
903103085 1:21050519-21050541 CACCCGAAAGGGGTGCGAGACGG + Intronic
903163765 1:21507251-21507273 CTCCCCAAAGCTATGAGGGACGG - Intergenic
903293951 1:22331987-22332009 CTCCAGGCAGGGGTGGGGGATGG + Intergenic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
904930431 1:34082548-34082570 CTCCCAGACGGGGTGGTGGACGG - Intronic
905028597 1:34866975-34866997 CTCCCCAGAGAGGTGGAGGGTGG - Intronic
905829887 1:41057098-41057120 CAACCCAAAGAGGTGGGGGCGGG + Intronic
905864991 1:41371861-41371883 CTTCCCAGAGTGTTGGGGGAGGG - Intronic
906061012 1:42948528-42948550 CGGCTCAAAGGAGTGGGGGAGGG + Intronic
906617509 1:47244005-47244027 GGCCACAAAGGGGTGAGGGAGGG - Intergenic
906679179 1:47713613-47713635 GTCACCACAGGGTTGGGGGAAGG - Intergenic
907387754 1:54136883-54136905 CTCCCACAAAGGGTGGTGGATGG + Intronic
907413490 1:54298410-54298432 CTCCCCAGAGTGGTGGGAGTAGG - Intronic
907450135 1:54541115-54541137 CTCCCCAGAGTTGTGGGGGCAGG + Intergenic
907528896 1:55073035-55073057 TTCCCCCAGGGGCTGGGGGAAGG + Intronic
907906279 1:58785344-58785366 CGTCCCTAAGGGGTGGGGGGCGG - Intergenic
907963487 1:59306464-59306486 AGACCCAAAGGGGTGAGGGAAGG + Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912379835 1:109241326-109241348 CTCCCCATGGGGGTGGGGTGGGG + Intergenic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915982172 1:160427069-160427091 GTCCCCAAAGGGGTGGGTTGTGG + Exonic
916265346 1:162885163-162885185 CTCCCCAGAGTGGTGGGAGTTGG + Intergenic
917206097 1:172572173-172572195 CTCCCAAACGGGGTGGTGGCTGG - Intronic
917287870 1:173440388-173440410 TTTCCCAATGGGGTGGGGGAGGG + Intergenic
918346138 1:183609106-183609128 CTCCCCAAATGGGTGCTGGGTGG - Intergenic
918453903 1:184687532-184687554 CTCCCCAAAGGGGTGAGAATAGG - Intergenic
918526458 1:185470129-185470151 ATAGCCAAAGAGGTGGGGGAGGG - Intergenic
918774359 1:188609677-188609699 CTCCCCAACGGGTAGGGTGAGGG + Intergenic
919933072 1:202234224-202234246 CCACCCCAAGGGGTGGGGAAGGG - Intronic
920648496 1:207820217-207820239 CTCCCCACAGGGCTGTGGAAAGG + Intergenic
920678446 1:208054954-208054976 CTCCCTAAAGGAGTGGGTGAGGG + Intronic
922235232 1:223717642-223717664 TTCCCCAGAGGGGAGGGGAAGGG + Intronic
923372358 1:233327378-233327400 CGGCCCAAGGTGGTGGGGGACGG + Intergenic
924010172 1:239656142-239656164 ATCCCCAAATGGGAGAGGGAAGG + Intronic
1062768921 10:84806-84828 CACACCCAAGGGGTGGGGCATGG + Intergenic
1063822665 10:9855598-9855620 CTCCCAGAAGGGGTGGCGGTCGG + Intergenic
1065960796 10:30732531-30732553 CTCCCCAAAGGGCGAGGAGATGG - Intergenic
1067346830 10:45443593-45443615 CACCCCGGAGGGGTGGCGGAGGG - Intronic
1069616606 10:69810621-69810643 CAACCCAAAGAGGTGGGAGAAGG - Intronic
1069752465 10:70753068-70753090 AACCCCAAAGGGGTAGGGGCTGG - Intronic
1069789950 10:71013128-71013150 GTCCCCAAGTGGGTGGGGGTGGG - Intergenic
1069802468 10:71090621-71090643 CTTCTCAATGGGGTGGGAGAGGG + Intergenic
1070767117 10:79063192-79063214 ACCCCGAGAGGGGTGGGGGAAGG - Intergenic
1071148695 10:82606984-82607006 CTCCCCAAGAGGTTTGGGGATGG - Intronic
1071342867 10:84664650-84664672 CTCCACAATGGGCTGGGGAAGGG + Intergenic
1071802264 10:89076837-89076859 CTCCTCATGGGGGTGGGGGGGGG - Intergenic
1072099631 10:92216775-92216797 CTCCTCATAGGGGTAGGGGCAGG - Intronic
1072654572 10:97320907-97320929 CTTCTCAGAGTGGTGGGGGAAGG + Exonic
1073074385 10:100814679-100814701 CTCCCCAGTGGGGTGGGGGCAGG + Intronic
1073422422 10:103434870-103434892 CTTCCCAAAGGGGAAGGAGACGG - Exonic
1073791175 10:106941949-106941971 TTCCCCAAAGGTGTGGAGGTGGG + Intronic
1074377356 10:112951184-112951206 CTTCCCAGAGGGGTGGAGGTGGG - Intronic
1074401197 10:113142330-113142352 TTTCCCAAAGGGGAGAGGGAGGG + Intronic
1075048677 10:119165857-119165879 CTCCCCAAAGGTGCGGAGCAGGG - Intergenic
1075520056 10:123137732-123137754 GGCCCCAGAGGGGTGGGGGAGGG + Exonic
1076167853 10:128296773-128296795 CTGCCAAAAGGGGTGGGGCCAGG + Intergenic
1076331882 10:129676104-129676126 CTCCCCATCTGGGTGTGGGACGG - Intronic
1076502157 10:130945685-130945707 CTCCCTGGAGGGGTGGGGGTGGG + Intergenic
1076601451 10:131659320-131659342 CTTCCCAGAGGGATGGAGGATGG - Intergenic
1076733038 10:132447598-132447620 TTTCCTAACGGGGTGGGGGATGG + Intronic
1077110020 11:858215-858237 CTCTCCAAAGGGGTGGGTGGGGG + Intronic
1077543718 11:3159769-3159791 CAGCCCATAGGGGTGGGGTAGGG + Intronic
1078363812 11:10690910-10690932 CTCCCCAAGGGGCAGGGGCAGGG + Intronic
1078367691 11:10720354-10720376 CTCCCCTTGGAGGTGGGGGAAGG + Intergenic
1080636392 11:34127530-34127552 CTTCACCAAGGGGAGGGGGATGG - Exonic
1081610292 11:44558426-44558448 CTCCCTAAAGGCGTGGCCGATGG + Intergenic
1081611435 11:44565535-44565557 CTTCCCAAAGGGCTCGGGGGCGG + Intronic
1081741063 11:45440996-45441018 GTGCCCACAGGGGTGGGGGCAGG - Intergenic
1081806938 11:45896027-45896049 CTGCACAGAGGGGTGGGGAATGG - Intronic
1081832180 11:46122438-46122460 CTCCCGGGAGGGGCGGGGGACGG + Intergenic
1081966678 11:47174308-47174330 CTCCTCAAAGGGGTGGGGCGGGG + Intronic
1083434184 11:62631375-62631397 CACCCCAAACTGGTGGGGTAGGG - Intronic
1083617659 11:64034664-64034686 CTCCCCAAGGGGATCTGGGAGGG + Intronic
1083827142 11:65210272-65210294 CTGCCCAACAGGATGGGGGAGGG - Intronic
1084128896 11:67118795-67118817 CCTCCCAGGGGGGTGGGGGAGGG + Intergenic
1084215663 11:67645645-67645667 CTCCCCAGAGGGGAGTGGGAGGG - Intronic
1085104811 11:73833093-73833115 CTCCCCAAAAGGGTCAGTGAAGG + Intronic
1085392228 11:76188340-76188362 CTACCCTAAAGGGTGGGGCATGG + Intronic
1085791405 11:79500217-79500239 CTCCCAGAAGGGGTGGCGGCCGG - Intergenic
1086003205 11:82004085-82004107 CTCCCGTGAGGGGTGGGGCATGG - Intergenic
1086437540 11:86797226-86797248 CTCCCCAGTGGGGAGGGGGTCGG - Intronic
1086454091 11:86944511-86944533 CAACCCAAAGGGGTTGGAGAAGG - Intronic
1088257273 11:107912948-107912970 CTCCCCGACGGGGTGGTGGCCGG - Intronic
1089000468 11:115047813-115047835 TTCCCAAAAAGGGTGGTGGAAGG - Intergenic
1089131861 11:116218612-116218634 CTCCCCAGAGGTGTGTGGGATGG + Intergenic
1089322607 11:117636561-117636583 CTCCACGAAGGAGAGGGGGAAGG + Intronic
1089493985 11:118899367-118899389 GAGCCCAGAGGGGTGGGGGAGGG + Exonic
1090234876 11:125139849-125139871 CTGCCCAAAGCAGGGGGGGAGGG - Intergenic
1090384011 11:126346018-126346040 CTCCTCAAAGGAGAGGTGGATGG - Intergenic
1090388211 11:126368922-126368944 TTCTCCAACGGGGTGGGGGAGGG - Intronic
1090390949 11:126386901-126386923 TTCTCCAGCGGGGTGGGGGAGGG - Intronic
1090765216 11:129870473-129870495 CTCCCCACTGTGGTGGGGGAGGG + Intronic
1091004570 11:131941336-131941358 CTCCCCAAAAGGGTGGTGGCTGG - Intronic
1091342359 11:134825750-134825772 CTCCCCAAAGAGGCGTGGGGTGG - Intergenic
1092886174 12:12926377-12926399 TACCCCAAAGAGGTGGGGGTGGG + Intergenic
1093653909 12:21674183-21674205 CTCCCCAAGGGGCAGGGGCAGGG - Intronic
1096670880 12:53197659-53197681 CTCCCCTAGGGGGTGGGCGGCGG + Exonic
1096826934 12:54286552-54286574 TTCCCCAAATGGTGGGGGGATGG + Intronic
1096856862 12:54489372-54489394 TTCCAGAAAGGGGTGGAGGATGG - Intergenic
1100523823 12:95401936-95401958 CACCCCAGAGGAGTAGGGGATGG + Intergenic
1101393320 12:104323324-104323346 CTCCCAGAAGGGGTGGTGGCCGG + Intronic
1101921165 12:108934324-108934346 CTTCCCAAGGGGGTAGGGAAAGG - Intronic
1102173473 12:110859727-110859749 ATCCACAAAGGGGTCCGGGAAGG + Intronic
1103148699 12:118618122-118618144 TTCCCCAAATGGGTGGGGGAGGG + Intergenic
1103350073 12:120278069-120278091 CTCCCAGAAGGGGTGGTGGCTGG + Intergenic
1104388820 12:128374461-128374483 CTCTGCAGAGGGGTGTGGGAAGG + Intronic
1104825074 12:131702143-131702165 CTGCCCAAAGGGGTAGAGGGAGG - Intergenic
1105511820 13:21058421-21058443 CTCCACCAAGGGGTGGGGTAGGG - Intronic
1106991834 13:35429088-35429110 TTCCCCAGTGGGGAGGGGGAGGG + Intronic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1108351780 13:49594651-49594673 CTCCCCACAGGGTTGGCTGAGGG + Intergenic
1108648125 13:52450459-52450481 CTTCCCAACGGGCTGGCGGAAGG - Intronic
1109660511 13:65452785-65452807 CTCCACAAAGAGGGGAGGGAGGG - Intergenic
1113992956 14:16042623-16042645 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1117368281 14:55052118-55052140 CGCCGGGAAGGGGTGGGGGAGGG - Intronic
1118925408 14:70187097-70187119 CACCCGAAGGGGGTGGGGGGAGG - Intronic
1120169482 14:81234486-81234508 CTTGCCAAAGGGCTGGGGGGTGG + Intergenic
1121223988 14:92308042-92308064 CACCTCAAAGGGGTGGGGCTGGG - Intergenic
1121254295 14:92519990-92520012 CTCTCCACAGGGGTAGGGGTTGG + Intronic
1122387816 14:101361010-101361032 CTCCCCAAAGAGGTGGATTAGGG + Intergenic
1124956336 15:34362911-34362933 CTCCCCACCTGGGTTGGGGAAGG - Intronic
1125485689 15:40109229-40109251 GTCCACAAAGGGAGGGGGGAAGG + Intergenic
1125526039 15:40375512-40375534 GTCCACTGAGGGGTGGGGGAAGG - Intergenic
1126615429 15:50574048-50574070 CTCCCTCTGGGGGTGGGGGAGGG + Intronic
1127354982 15:58189440-58189462 CACCCGAAAGAGGTGGGGTAGGG - Intronic
1127375610 15:58381972-58381994 CTACCCAGAGGGGTCTGGGAAGG + Intronic
1127613211 15:60657332-60657354 CTTCCCCAGGGGGTGGGGCAGGG - Intronic
1128312100 15:66637253-66637275 CTCCCACAGGGGTTGGGGGATGG + Intronic
1129944164 15:79524660-79524682 CTCCCCAGAGGGATGGTGGAGGG + Intergenic
1130146226 15:81275540-81275562 TTAAACAAAGGGGTGGGGGAAGG + Intronic
1130230272 15:82091618-82091640 CCCCCAAAAGGGGTGGGGGAGGG + Intergenic
1130305265 15:82709227-82709249 CTTCCCAAAAATGTGGGGGAGGG - Intronic
1130440175 15:83945342-83945364 CACCCCAAAGGAGGGTGGGAAGG + Intronic
1130814358 15:87415171-87415193 CTCCCCAAAGTTATGGGGGAGGG + Intergenic
1131134622 15:89924343-89924365 CTCAACAAAGGGATGGGGAAGGG + Intergenic
1132797298 16:1731420-1731442 CTCCCCACAGAGGTGGGACAAGG + Intronic
1133279895 16:4659383-4659405 CTCCCCAGAGGGGCTGGGGAGGG - Intronic
1133595549 16:7287849-7287871 CACACGAAATGGGTGGGGGAAGG - Intronic
1135114783 16:19715329-19715351 CTCCTCAAAAGGGTGTTGGAGGG + Intronic
1135776235 16:25259005-25259027 CAACGCAAAGGGGTGGGGGTGGG + Intergenic
1135927492 16:26708365-26708387 CTCCCCAATGGGGTGGGAGAGGG - Intergenic
1136383462 16:29908121-29908143 TTGACCAAAGGAGTGGGGGAGGG + Intronic
1136912325 16:34154375-34154397 CGCCGACAAGGGGTGGGGGAAGG - Intergenic
1136999055 16:35213079-35213101 CACCCCAAAGAGGTGGGGCCTGG - Intergenic
1137430774 16:48416703-48416725 CTCCCAAAAGGGGTGGCGGCCGG + Intronic
1137493641 16:48952218-48952240 CTCCCAGAAGGGGTGGTGGCCGG - Intergenic
1139201720 16:64984216-64984238 CTCCCCAGCGAGGTGGGGGTTGG + Intronic
1139391576 16:66609096-66609118 CTCCCCAATGGAGAGCGGGAAGG + Intronic
1139514418 16:67444925-67444947 CCCCCCAAACGGGCGGGGGCAGG + Intronic
1139908004 16:70380087-70380109 CTCTCTAAAACGGTGGGGGAGGG + Exonic
1140744737 16:77971573-77971595 TTCCTTAAAAGGGTGGGGGAAGG - Intronic
1140822679 16:78678097-78678119 CTCTCCAGTGGGGAGGGGGAGGG - Intronic
1141008563 16:80375964-80375986 CTCCTCATTGGGGTGGGGAAGGG - Intergenic
1141660198 16:85437276-85437298 CCCCCAAAAGAAGTGGGGGAGGG + Intergenic
1141896234 16:86960334-86960356 CTCCACGAAGCGCTGGGGGAGGG - Intergenic
1142860109 17:2755973-2755995 CTCTCCAAAGAGATGGGCGACGG + Intergenic
1143167123 17:4902322-4902344 CAATCCTAAGGGGTGGGGGATGG + Exonic
1143263331 17:5616760-5616782 CTTCCCAAAGGGCTTAGGGAGGG - Intronic
1143729673 17:8874071-8874093 GCCCCCAGAGGGATGGGGGATGG + Intergenic
1145062716 17:19742988-19743010 CCCCCAACAGGGGTGGGGGAAGG + Intronic
1145735845 17:27231176-27231198 TTATCAAAAGGGGTGGGGGAAGG + Intergenic
1146543543 17:33718702-33718724 ATCCCCAAAGAGGTGGGAGGTGG + Intronic
1146558886 17:33851085-33851107 ATCCCCAAAGGGGTCAGGTAGGG + Intronic
1146678969 17:34793420-34793442 CTCCCCAGAGGCGAGGGGGAGGG - Intergenic
1147363674 17:39946617-39946639 CCGACCAAAGGGGTGGTGGAGGG - Intergenic
1147589823 17:41675172-41675194 CCCCTGAAAGAGGTGGGGGAGGG - Intergenic
1148090649 17:45020817-45020839 CACCCCTGAGGGGTGGGGGGTGG - Intergenic
1148245984 17:46031137-46031159 CTGCCCACAGGTGTGAGGGAGGG + Exonic
1148323205 17:46769747-46769769 CTCCCTGAAGGGTTTGGGGAGGG + Intronic
1148356220 17:46977666-46977688 CATCCCATAGGGGTGGGGGTTGG - Intronic
1148509088 17:48153643-48153665 CTAATCAAAGGGGTGGGTGAGGG - Intronic
1148564878 17:48626789-48626811 CTCCCCAGGCGGGTCGGGGAGGG + Intronic
1148697189 17:49567680-49567702 ACCCCAAAAGGGGTGGAGGAAGG + Intergenic
1148796079 17:50197485-50197507 TTCCCCAAAGGGATGGGGTTGGG + Intronic
1148822715 17:50369381-50369403 ATCGAAAAAGGGGTGGGGGAGGG + Intronic
1149075754 17:52595166-52595188 CTCCCCAAAGGGGCAAGAGAAGG + Intergenic
1150122431 17:62615425-62615447 TTTCCCAATGGGGTGGGGGAGGG + Intronic
1150136473 17:62698085-62698107 CTTCCCAAAGCAGTGGCGGAGGG + Intergenic
1150951785 17:69810663-69810685 CTCCGCAATGGGGCGGGGGCGGG + Intergenic
1151319903 17:73346789-73346811 CTCTCCAAAGACCTGGGGGAAGG + Intronic
1151863271 17:76782128-76782150 CTCCCCACAGGGGCCGGGGGCGG - Intergenic
1154314045 18:13289981-13290003 CTCCCCAACAGGGTATGGGAAGG - Intronic
1155050853 18:22146555-22146577 CTCCCCGTAGTGGTTGGGGATGG + Intergenic
1155938034 18:31774691-31774713 GTCCCCAAATGTGTGGGAGAGGG - Intergenic
1156553601 18:38043442-38043464 CTGCTCAAAGGGGAGAGGGAGGG + Intergenic
1157100024 18:44720910-44720932 CTCCCCAAGGGGTTGGGGTGGGG - Intronic
1158674389 18:59505150-59505172 CTCCCCAGTGGGGTGGAGGGAGG + Intronic
1159001620 18:62980096-62980118 CTCCTCAGAGGGGAGGGGGAGGG - Exonic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161112862 19:2479446-2479468 GTCCCGAAGGGGTTGGGGGAGGG + Intergenic
1161262815 19:3346856-3346878 CTCCCGGGAGCGGTGGGGGAAGG + Intergenic
1161310187 19:3589744-3589766 CTTCCCTTAGGGGTGGGGGTCGG + Intronic
1161756111 19:6135579-6135601 CTTCCCCTAGGGGTGGGGGTGGG + Intronic
1161849455 19:6731100-6731122 CTCCACCAAGAGCTGGGGGACGG + Exonic
1162936327 19:13983452-13983474 CCCTCCCAGGGGGTGGGGGAGGG - Intronic
1163654468 19:18537826-18537848 CTCCGCAGAGGGGTGGGTGCCGG - Intronic
1163686494 19:18714850-18714872 CCCTCCAAAGGGCTGAGGGAGGG - Intronic
1163822141 19:19502164-19502186 TTACACAGAGGGGTGGGGGAGGG - Intronic
1163843940 19:19628249-19628271 CTCCCCCAGGTGGTGGGGGCGGG - Intronic
1164480657 19:28608913-28608935 CCCCCCAAAGGGGCGAGAGAAGG + Intergenic
1164489124 19:28690567-28690589 CACCCCAATGGGGAGGGGGCAGG - Intergenic
1164643624 19:29843499-29843521 CTCCTCCCAGAGGTGGGGGATGG - Intergenic
1164834465 19:31348956-31348978 CTCCCCAAATGGGTGCGAGAGGG + Intronic
1165362639 19:35346257-35346279 CTCCCCAGAGGGGCTGTGGAAGG + Intronic
1165814356 19:38632520-38632542 CTCCCCAAGGGGAAGGGGTAGGG + Intronic
1166392789 19:42419343-42419365 CTGCACAAAGGAGTGGGGAAGGG + Intronic
1166621843 19:44308310-44308332 TTCCTTAAAGGGGTGGGGAAGGG + Intergenic
1167195356 19:48024424-48024446 CACCCCAAAGGGAGGAGGGATGG - Intronic
1167237351 19:48322957-48322979 CTCCCTGAGGGGGTGAGGGATGG - Intronic
1167412995 19:49355971-49355993 CTGCCCGTGGGGGTGGGGGAGGG + Intronic
1167650804 19:50727648-50727670 CCCCGCAAGGGGCTGGGGGAAGG - Intergenic
1168124826 19:54277539-54277561 ATCCCCAAAGTGGTGAGTGAGGG - Exonic
925376530 2:3389657-3389679 CAGCCGAAGGGGGTGGGGGATGG + Intronic
926047115 2:9717885-9717907 CTCCCCAGAGGAGCTGGGGAGGG - Intergenic
926121394 2:10243068-10243090 CTCCCAGATGGGGTGAGGGAAGG - Intergenic
926317274 2:11719998-11720020 CTGCCCACTGGGGTGGGAGAAGG - Intronic
926697730 2:15782461-15782483 CCCCCCTCAGGGGTGGGAGAGGG - Intergenic
926701896 2:15809571-15809593 CTCCCCAAAGTCCTCGGGGAAGG - Intergenic
926722767 2:15973883-15973905 CACCAAAAAGGGGTGGGAGAGGG - Intergenic
927787294 2:25982566-25982588 CTCCCGACTGGGGTGGGGCAGGG + Intronic
928009482 2:27594366-27594388 CTCCCAGAAGGGGTGGCGGCCGG + Intronic
928481147 2:31685032-31685054 CTCCCTAATGGGGTGGGGGCAGG + Intergenic
928673428 2:33626155-33626177 AGACCCAAAGGGGTGGGGGGAGG - Intergenic
928696619 2:33856015-33856037 CTCCCCAAGGAGTTTGGGGATGG + Intergenic
929316623 2:40486871-40486893 CTCTACAAAGGGGTGGGGGGAGG - Intronic
930247906 2:49003776-49003798 CTACTCCAAGGGGTGGGGGTGGG - Intronic
930363582 2:50411593-50411615 CTCCCAGAAGGGGTGGCGGTGGG - Intronic
932614900 2:73225777-73225799 CTCCCTGCAGCGGTGGGGGATGG - Exonic
932844343 2:75120011-75120033 CTCCCCTGAGGGGTGAGAGATGG + Intronic
934765573 2:96878343-96878365 CTCCCCCAAGCGGCGGGGGTTGG - Intronic
935449991 2:103198418-103198440 CTCTCCTAAGGGGTGGGGTGGGG - Intergenic
937043374 2:118837585-118837607 CTCCCCACAGGTATGGGGGTGGG - Intergenic
937487579 2:122331820-122331842 TTGCCCGAAGGGGTGAGGGATGG + Intergenic
937734902 2:125277212-125277234 CTCCCAGAAGGGGTGGCGGTCGG + Intergenic
937897764 2:126991410-126991432 CTACCCAAAGGGCTGGGAAAAGG - Intergenic
938538744 2:132268259-132268281 CGCCGGCAAGGGGTGGGGGAAGG + Intergenic
938804076 2:134789680-134789702 GCCCCCAGAGGGGTGGGGGCAGG + Intergenic
939880361 2:147624150-147624172 TCCCCCAAAGAGTTGGGGGAAGG - Intergenic
940693981 2:156956077-156956099 CTCTGCAGAGGGATGGGGGATGG + Intergenic
943125797 2:183792437-183792459 CTCCCAAACGGGGTGGCGGCCGG + Intergenic
943365179 2:186961924-186961946 GTCTCGAAAGGGGTGGGGGGAGG - Intergenic
944615320 2:201453036-201453058 CCCAGCAAAGGGGTGGGGGTGGG - Intronic
945143820 2:206715331-206715353 CTCCCCAGAGGCGAGGGGGAGGG + Intronic
946333788 2:219024462-219024484 CTCCAGAAAGGGGCGGGGGGGGG + Intronic
947498177 2:230653995-230654017 CTCCCCAAAGGCAAGGGGGTGGG + Intergenic
948311979 2:236994127-236994149 GTCGGGAAAGGGGTGGGGGAGGG - Intergenic
948897910 2:240935735-240935757 CTCCCCGTGGGGGTGGGGGCAGG + Intronic
1170424680 20:16227058-16227080 CTCCCAGAAGGGGTGGTGGCCGG + Intergenic
1170508548 20:17054195-17054217 GCTCCCAGAGGGGTGGGGGATGG - Intergenic
1171769914 20:29314411-29314433 CACTCCAAAGGGGAGGAGGAGGG + Intergenic
1171812067 20:29753154-29753176 CGCCGGCAAGGGGTGGGGGAAGG + Intergenic
1171907609 20:30912523-30912545 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1172194297 20:33081641-33081663 AGCCCCAAAGGGGTGAGGGTTGG + Intronic
1172297661 20:33824829-33824851 GTCCCCAAAAGGGTGGGGGGAGG + Intronic
1175245199 20:57578017-57578039 CACATCAAAGGGGTGGGGAAGGG + Intergenic
1175391571 20:58631002-58631024 CTCTCCAAAGGGGAGTGGGCTGG + Intergenic
1175940501 20:62535515-62535537 CTCCCCAAGAGGGTGGCTGAGGG + Intergenic
1176122420 20:63460153-63460175 GTCCCCAAAGGTGCTGGGGATGG - Intronic
1176300115 21:5095379-5095401 CTCCCCACAGGGGTGTGAGGAGG - Intergenic
1176360738 21:5995052-5995074 CTACCCCAGGGGGTGGGGCAGGG + Intergenic
1176552803 21:8236298-8236320 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1176571701 21:8418701-8418723 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1176579612 21:8463263-8463285 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1177225343 21:18245627-18245649 CCTGCCAAAGGGGTGGGGTAGGG + Intronic
1179625172 21:42645195-42645217 CTGCGCAAAGGGGATGGGGAGGG + Intergenic
1179762780 21:43543498-43543520 CTACCCCAGGGGGTGGGGCAGGG - Intronic
1179856907 21:44166532-44166554 CTCCCCACAGGGGTGTGAGGAGG + Intergenic
1179969977 21:44830599-44830621 CACCCAAAAGGGGTGGGGGTGGG + Intergenic
1180314313 22:11264896-11264918 CGCCGGCAAGGGGTGGGGGAAGG + Intergenic
1180341045 22:11618655-11618677 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1180830251 22:18902005-18902027 CTTGCCTAAGTGGTGGGGGATGG - Intergenic
1180842529 22:18965982-18966004 CTCCCTGCAGGGGTGGGGGAGGG + Intergenic
1181005603 22:20012082-20012104 TTCCCCAACTGGGTGGGGGGGGG - Intronic
1181058952 22:20272874-20272896 CTCCCTGCAGGGGCGGGGGAGGG - Intronic
1181284331 22:21741140-21741162 CTCCACATAGGCGTGGGTGATGG + Intergenic
1181625123 22:24118053-24118075 CACCTCAAAGGGTAGGGGGAGGG + Intronic
1181712277 22:24697971-24697993 CTCCCCAGGTGGCTGGGGGAAGG - Intergenic
1181779977 22:25185452-25185474 TTCCCCAAAGGGGAAGAGGAGGG - Intronic
1181924910 22:26350520-26350542 TTGCCCAAAGAGGTGGGGCACGG - Intronic
1182524713 22:30907969-30907991 CTGCCCAAAGGGCTGGGGAGAGG + Intergenic
1183455172 22:37918669-37918691 CCCCGCAAAGGGGAGGAGGAGGG + Intronic
1183691135 22:39389015-39389037 ACCCCAAAAGGGATGGGGGATGG + Intergenic
1184038530 22:41929795-41929817 CTCCTAAATGGGGTGGGGGTGGG + Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184512519 22:44941931-44941953 CTCACAGATGGGGTGGGGGATGG - Intronic
1185026144 22:48414416-48414438 CTCCCAAAAAGGGCGGGGGGTGG - Intergenic
1203257780 22_KI270733v1_random:152698-152720 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1203280340 22_KI270734v1_random:127276-127298 CTTGCCTAAGTGGTGGGGGATGG - Intergenic
951927219 3:27921622-27921644 CTCTGCATGGGGGTGGGGGAAGG + Intergenic
952479771 3:33749123-33749145 CTCCAGAAAGGGATGGGGAAGGG + Intergenic
953143477 3:40250850-40250872 CTGCCCAAAGGGCAGGGAGATGG + Intronic
953399625 3:42601139-42601161 CTCCCAAAAAGGCCGGGGGAGGG - Intronic
954364185 3:50137648-50137670 CTTGCCATAGGGGTGGGGGTGGG - Intergenic
954566888 3:51607626-51607648 CTCCCAGACGGGGTGGTGGATGG + Intronic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
957044779 3:75365070-75365092 CTCCCCAAAGAGGCAAGGGAAGG - Intergenic
957426836 3:80051021-80051043 CTCCCCACAGTGGTGGTGGGCGG - Intergenic
957948925 3:87098962-87098984 CCCCCCAAAGTGCTGGGGGGGGG - Intergenic
962045233 3:131752041-131752063 CTCCCCAGCGACGTGGGGGAAGG + Intronic
963603797 3:147397578-147397600 CTCCCCAAAGTTGTGGTGAATGG - Intronic
965189857 3:165514263-165514285 CTACACAAAAGGGTGGGGAATGG - Intergenic
967075784 3:186000572-186000594 GTCCCCAAAGGTGTGGGGTACGG - Intergenic
968669263 4:1839994-1840016 AAACCCAAAGGGGTGGGGGTGGG + Intronic
968727067 4:2252676-2252698 CTCCTCCTGGGGGTGGGGGACGG - Intronic
968921356 4:3523847-3523869 CTCCCCACTGTGGTGGGGGTGGG - Intronic
969531483 4:7733252-7733274 CTGCCAAAAGGGAAGGGGGATGG - Intronic
972587294 4:40449602-40449624 CTCCCGAAAGGGGTGGAGTGGGG + Intronic
972726584 4:41750896-41750918 CTCCCTTAAGTGGTTGGGGAGGG - Intergenic
974321173 4:60352521-60352543 TTTCCCAATGGGGTGGGGGAAGG - Intergenic
974835776 4:67249049-67249071 TTCCCCAAGGGAGTGAGGGATGG - Intergenic
976228354 4:82814859-82814881 CTCTCAAAAGAAGTGGGGGAGGG - Intergenic
977007634 4:91591028-91591050 TGTCCCCAAGGGGTGGGGGATGG - Intronic
977399045 4:96509196-96509218 CACTACTAAGGGGTGGGGGAGGG - Intergenic
977408755 4:96634421-96634443 CTCCACAAATGAGTGGGGGCTGG - Intergenic
978168011 4:105632024-105632046 ATCCCCAACGGGGATGGGGATGG + Intronic
979273776 4:118792366-118792388 CTCCCAGAAGGGGTGGCGGCCGG - Intronic
979913931 4:126405692-126405714 CTTCCCCAAGGAGTAGGGGAAGG + Intergenic
981008619 4:139901622-139901644 CTCCCCATAAGGGAGGAGGATGG + Intronic
981939443 4:150266444-150266466 GTCCCCAAAGAGGTGGTGCAGGG + Intronic
981994852 4:150963984-150964006 CTCCCAGAAGGGGTGGCGGCAGG - Intronic
983938829 4:173521704-173521726 CTCCCTGGAGGGCTGGGGGAAGG + Intergenic
984953273 4:185021595-185021617 ATCCCCTAAGGGGTGGGGAAGGG - Intergenic
986015645 5:3754750-3754772 CTCCCCAGAGAGGAGGTGGAGGG + Intergenic
987323565 5:16792570-16792592 CTCCCCACAGGAGCGGGGGGCGG + Intronic
987789150 5:22541619-22541641 ATCCCCACTGGGGTGGGGGATGG - Intronic
990364084 5:55051734-55051756 CACCCACAATGGGTGGGGGATGG + Intergenic
990582254 5:57175725-57175747 CCCAACAACGGGGTGGGGGAAGG - Intronic
990609336 5:57441738-57441760 AGCCCCAATGGGGTGGGTGATGG + Intergenic
990618379 5:57531306-57531328 CACCCCAAAGGGGCACGGGAGGG + Intergenic
996587802 5:125110487-125110509 CTCCCCAAAGGGTGGGGCAAAGG + Intergenic
996866151 5:128124762-128124784 CTCCCCTAAGGTGTGAGGGGTGG + Intronic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
998061969 5:139125971-139125993 CTCCCCAAAGGCATTGGGGCAGG - Intronic
998148342 5:139743196-139743218 CTCTCCAAAGTCTTGGGGGATGG + Intergenic
998373114 5:141673594-141673616 CTCCCCTCAGGGGTGGGTGCTGG - Exonic
998434958 5:142100292-142100314 CTCCCCACAAGGGTGGGGACAGG + Intergenic
998441875 5:142169438-142169460 CTCCCCACAGGGGTTGTGGCTGG + Intergenic
998513799 5:142735306-142735328 CTCCCCTAAGGAGCTGGGGAGGG - Intergenic
999251322 5:150183942-150183964 AGCCCCAAATGGTTGGGGGAGGG + Exonic
999339676 5:150759188-150759210 CTCACAAAAGCGCTGGGGGACGG - Intergenic
1000056229 5:157608915-157608937 CTCCCCGAAGGAGAAGGGGAAGG - Intergenic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1000985894 5:167860516-167860538 CTCCCAGAAGGGGTGGTGGCCGG - Intronic
1003014339 6:2455983-2456005 CTCTCCAGCAGGGTGGGGGATGG - Intergenic
1003515359 6:6813517-6813539 TTCCCCAAAGGGGCGGTGGTAGG - Intergenic
1004504479 6:16237197-16237219 CTCATAAAAGGGGTGGGGGCAGG - Intergenic
1004736275 6:18409502-18409524 CAACCCAAGAGGGTGGGGGAGGG - Intronic
1006826927 6:36941948-36941970 CTCCCAGAAGGGGTGGCGGCGGG - Intergenic
1007776623 6:44227614-44227636 CTCCCCACAGTGGTGGCGGGAGG - Intronic
1007922286 6:45621282-45621304 CTCCCCGGAGGTGTGGGGGTTGG - Intronic
1010949087 6:82013754-82013776 CTTCCCACAGGGGTGTGGTAGGG + Intergenic
1011329477 6:86187781-86187803 CTCCCTTAAATGGTGGGGGAAGG - Intergenic
1011474122 6:87735859-87735881 CTCCCAGAAGGGGTGGCGGCCGG + Intergenic
1013016454 6:106164492-106164514 CTGCCCAAGGGGTTAGGGGAAGG + Intergenic
1013626342 6:111940924-111940946 AGACCCAAAGGGATGGGGGAGGG - Intergenic
1014104000 6:117542785-117542807 CTCACCTGAGGGGTGGGGGAGGG + Intronic
1014520752 6:122439286-122439308 CTCCTCAGAGAGCTGGGGGAAGG + Intergenic
1015321034 6:131875051-131875073 CTCCCCAAAGGTGGGAGGGCAGG + Intronic
1015745682 6:136507167-136507189 CTCCCCAGAAAAGTGGGGGAAGG + Intronic
1015976457 6:138796078-138796100 CTCCGGAGAGGGGTGGGGCAGGG - Intronic
1016035219 6:139376811-139376833 CTCCTTTAAGGGATGGGGGATGG - Intergenic
1017493847 6:154966579-154966601 CTCCCCAACGGGGTTGCGGCCGG + Intronic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1018448180 6:163877851-163877873 CTAGCTACAGGGGTGGGGGAAGG - Intergenic
1019128311 6:169856543-169856565 CTCCCAAACGGGGTGGCGGCCGG + Intergenic
1019344091 7:521175-521197 CTCCCCAAATATTTGGGGGAAGG - Intergenic
1019704324 7:2490286-2490308 CTCCCCAGAGGGGCAGGGGGAGG + Intergenic
1019712611 7:2524461-2524483 CTCGCCCTGGGGGTGGGGGATGG - Intronic
1020133756 7:5574589-5574611 CGTCCCAGTGGGGTGGGGGAGGG - Intergenic
1022463687 7:30636299-30636321 CTCCCAAAAATGATGGGGGAAGG + Intergenic
1023925234 7:44664175-44664197 TTCCCCACTGTGGTGGGGGAAGG + Intronic
1023931499 7:44709103-44709125 CTCCCCTGAGGGGATGGGGATGG + Intergenic
1024229827 7:47355337-47355359 CACCACAACAGGGTGGGGGACGG + Intronic
1024420394 7:49159222-49159244 CTCTCCAAAGGTTGGGGGGAAGG + Intergenic
1026853955 7:73741088-73741110 CGCCCTAAGGAGGTGGGGGAGGG - Intergenic
1027230449 7:76268880-76268902 ATGCCCACAGGGGTGGGGGATGG - Intronic
1029287932 7:99478936-99478958 CTCCCCACTGGGCTGTGGGATGG + Intronic
1029451019 7:100641816-100641838 TTCCCATCAGGGGTGGGGGAAGG + Intronic
1032074975 7:128831933-128831955 CTCTCCACAGGGGTGGGCGGGGG - Intronic
1032709131 7:134447247-134447269 CTCCTCCATGGAGTGGGGGATGG - Intronic
1035076445 7:156180730-156180752 GTCCCCAAAGGGGAGGGTGGTGG + Intergenic
1035716037 8:1755613-1755635 CTGCCCAGAGGGCTGGGGGTTGG + Intergenic
1037828522 8:22174582-22174604 CTTCCCAAAGGGCAGGGGCAGGG + Intronic
1038401461 8:27287655-27287677 CTCCCCAAAGCGGGCGTGGAAGG + Exonic
1038489096 8:27956918-27956940 CTCTCCAAAAGGGTGGAGGACGG + Intronic
1039277990 8:35953924-35953946 CCCCCGAAAGGGGTGAGAGAAGG + Intergenic
1041021390 8:53642462-53642484 CTCCCCCAAGGAGTTCGGGATGG + Intergenic
1041270236 8:56104168-56104190 CTCCCAGAAGGGGTGGTGGCCGG + Intergenic
1042137514 8:65645693-65645715 CTCTACAAAGGGGGGGGGGGGGG - Intronic
1045612247 8:103859350-103859372 CTCCCCAAAGTGGTGGAAAAGGG - Intronic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1047878456 8:129166698-129166720 CTCCCCAAAGAGGGATGGGAGGG - Intergenic
1048239737 8:132729668-132729690 CTGCCAAAAGGGGTGGGGAGAGG + Intronic
1048945489 8:139443310-139443332 GTTTCCAACGGGGTGGGGGAGGG - Intergenic
1049529326 8:143146646-143146668 CTCCCCCCAGGAGTGAGGGAAGG + Intergenic
1049643016 8:143723824-143723846 CCCCCCACAGGGGTGGGTGGTGG + Intergenic
1050742387 9:8836967-8836989 TTCCCCAAATGGTGGGGGGATGG - Intronic
1051376786 9:16410205-16410227 CTCCCCAAAGGTGAGGGGAAGGG - Exonic
1051717327 9:19998764-19998786 ATCCCCCCAGGGGTGGGAGAAGG - Intergenic
1051754663 9:20385713-20385735 GTGCCCAATGGGGTGGGGTAGGG + Intronic
1054865813 9:69999908-69999930 TTCCCCAAAGGGTGGTGGGATGG + Intergenic
1058578978 9:106434498-106434520 ATACCCAGAGGGGTGGGGGGAGG + Intergenic
1059345503 9:113625367-113625389 CTCCCCAAAGGGCTGTTGGGTGG - Intergenic
1060402719 9:123357602-123357624 CTCCATAGAGGGGTGGGGCATGG + Intronic
1061666288 9:132162432-132162454 CGCCCCAGAGGGGTGTGTGAGGG + Intronic
1062561701 9:137144953-137144975 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561721 9:137145010-137145032 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561741 9:137145067-137145089 GTCCCCAGAGGGGTGGGGACCGG + Intronic
1062561763 9:137145124-137145146 GTCCCCAGAGGGGTGGGGACCGG + Intronic
1062561808 9:137145238-137145260 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561828 9:137145295-137145317 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1203473973 Un_GL000220v1:134721-134743 CGCCGGCAAGGGGTGGGGGAAGG - Intergenic
1185620405 X:1450421-1450443 GACCCCCTAGGGGTGGGGGAGGG - Intronic
1185621034 X:1452056-1452078 ACCCCCCTAGGGGTGGGGGAGGG - Intronic
1185621203 X:1452479-1452501 GTCCCCATAGGGATGGGGGAGGG - Intronic
1186141712 X:6581538-6581560 ATTCCCAAAGGGGTGGGAGCAGG + Intergenic
1186343122 X:8664039-8664061 CCTGTCAAAGGGGTGGGGGAAGG + Intronic
1187053592 X:15718569-15718591 CTCGCAGAAGGGGTGAGGGAAGG - Intronic
1189094188 X:38120734-38120756 CTTCCCCCAGGGTTGGGGGAAGG + Intronic
1189195713 X:39150582-39150604 CTCCCCATCCGGCTGGGGGAAGG - Intergenic
1189317084 X:40064017-40064039 ATCACTAATGGGGTGGGGGAGGG + Intronic
1190464158 X:50709038-50709060 CCTTCCAGAGGGGTGGGGGACGG + Intronic
1191900951 X:66040186-66040208 AACCCCAAGGAGGTGGGGGAAGG - Intergenic
1192019243 X:67367254-67367276 CACCCCAAAAGGGAGTGGGAGGG + Intergenic
1192216823 X:69165001-69165023 CTCCGCAAAGGGGCCGAGGAGGG + Intronic
1192428497 X:71097076-71097098 TTCCCAAAGGGGGTGGGGGTGGG - Intronic
1192428498 X:71097077-71097099 CTTCCCAAAGGGGGTGGGGGTGG - Intronic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1193222457 X:78942618-78942640 CTCTCCAAAGCTGTGGAGGAAGG - Intergenic
1194975996 X:100396492-100396514 CTCCCCAAGGGGCTGGAGGCAGG - Intronic
1195517488 X:105794046-105794068 CTCCCCAATGTGGTGGTGGTGGG - Intergenic
1196072566 X:111542773-111542795 GTCCAGAAAGGGGTGGGGGGTGG + Intergenic
1196119673 X:112036376-112036398 CTCCCCAAAGGGCTGATGCAAGG - Intronic
1197648666 X:129042343-129042365 CTCCCCATTGGGTTGGGGGGTGG + Intergenic
1199716395 X:150510066-150510088 GTTCCCAAAGGGGTGGGCAAGGG + Intronic
1199758398 X:150886648-150886670 GTCCCCTAGGGGGTGGGGGGTGG - Intronic
1199764712 X:150932678-150932700 CCCTCCAAAGGTGTGGGGGTGGG + Intergenic
1200698917 Y:6385776-6385798 CCCCCCAAAGTGGTGAGAGAAGG + Intergenic
1201035195 Y:9778923-9778945 CCCCCCAAAGTGGTGAGAGAAGG - Intergenic