ID: 904627469

View in Genome Browser
Species Human (GRCh38)
Location 1:31815102-31815124
Sequence CCTCAGCAGCACCTGCAGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 1, 2: 5, 3: 68, 4: 650}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904627458_904627469 22 Left 904627458 1:31815057-31815079 CCCGGCTCTGTACCACAGCTAGC 0: 1
1: 0
2: 0
3: 6
4: 134
Right 904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG 0: 1
1: 1
2: 5
3: 68
4: 650
904627457_904627469 23 Left 904627457 1:31815056-31815078 CCCCGGCTCTGTACCACAGCTAG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG 0: 1
1: 1
2: 5
3: 68
4: 650
904627463_904627469 -5 Left 904627463 1:31815084-31815106 CCAAGACCCCTGGCCGGACCTCA 0: 1
1: 0
2: 0
3: 9
4: 169
Right 904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG 0: 1
1: 1
2: 5
3: 68
4: 650
904627459_904627469 21 Left 904627459 1:31815058-31815080 CCGGCTCTGTACCACAGCTAGCA 0: 1
1: 0
2: 0
3: 10
4: 132
Right 904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG 0: 1
1: 1
2: 5
3: 68
4: 650
904627460_904627469 10 Left 904627460 1:31815069-31815091 CCACAGCTAGCAGCTCCAAGACC 0: 1
1: 0
2: 1
3: 16
4: 202
Right 904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG 0: 1
1: 1
2: 5
3: 68
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904627469 Original CRISPR CCTCAGCAGCACCTGCAGCC CGG Exonic
900093193 1:929476-929498 GCTCAGGGGCAGCTGCAGCCTGG - Intronic
900096599 1:942449-942471 CCGCAGGAGCTCCTGCTGCCAGG - Exonic
900302364 1:1984393-1984415 GCTCAGCAGCACCTGCGCCAGGG - Intronic
900371364 1:2333597-2333619 CAGCAGCAGCACCTTGAGCCAGG - Intronic
900627961 1:3618071-3618093 CCTTAGCAGCACCTACACACAGG + Intergenic
900634812 1:3657802-3657824 CCTCCACAGCCCCTGCATCCTGG + Intronic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
900716708 1:4149514-4149536 CCTGAGCTGAGCCTGCAGCCTGG + Intergenic
900945919 1:5831395-5831417 CCTCACCAGCTCCAGGAGCCAGG - Intergenic
901138162 1:7010939-7010961 CCTCACCAGCACCTGCACCTGGG - Intronic
901231331 1:7643082-7643104 CTTCAGAAGCACCTGGACCCTGG - Intronic
901496953 1:9627758-9627780 CCTCAGCACCAACAGCACCCGGG - Intergenic
901552018 1:10002613-10002635 CCTCAGCCTCCCCAGCAGCCAGG + Intronic
901762497 1:11479883-11479905 CCCCGGCCGGACCTGCAGCCAGG - Intronic
902234293 1:15047830-15047852 ACTCAGCAGCCCCTGCAGCTGGG + Intronic
902241815 1:15094804-15094826 GCTCAGCAGCACCTGCCCCCGGG - Exonic
902282198 1:15382865-15382887 CCTCTGCGGCTCCTTCAGCCGGG - Intronic
902368131 1:15990472-15990494 CTCCAGGAGCACCTCCAGCCAGG + Intergenic
902735724 1:18399400-18399422 CCCCGGGAGCACCAGCAGCCAGG - Intergenic
902787057 1:18739612-18739634 ACACAGCCACACCTGCAGCCTGG + Intronic
903163803 1:21507458-21507480 CCTCAGCCTCCCCAGCAGCCAGG - Intergenic
903280908 1:22249305-22249327 CCCCAGCACCTCCTGCAGGCAGG + Intergenic
903545607 1:24121644-24121666 CCTCAGCGGCCCCAGCAGTCTGG - Exonic
903950538 1:26993798-26993820 CCGCATCAGCGCCTGCGGCCCGG + Exonic
904020266 1:27458675-27458697 CCTCAGCACCCCGTGCAGCTGGG - Intronic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904534635 1:31190958-31190980 CCTCAGCTGCACCATGAGCCTGG - Intronic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG + Intergenic
904769839 1:32874817-32874839 CCTCAGCACCACCAGCACTCAGG - Intergenic
905247273 1:36623868-36623890 ACTCCGCACCACCTGCAGCCAGG - Intergenic
905446064 1:38029170-38029192 CCTCTGCTGCAGCTGGAGCCTGG + Intergenic
905653001 1:39668932-39668954 CTTCAGCTCCACCTGGAGCCTGG - Intronic
905991696 1:42342817-42342839 CCTCAGCATCCCAAGCAGCCGGG - Intergenic
906315696 1:44785199-44785221 CCTCAGAAGCTTCTGAAGCCAGG - Exonic
906959096 1:50404748-50404770 CCTCAGCCTCCCCAGCAGCCGGG + Intergenic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907846927 1:58217300-58217322 CCCAAGCAGGACCTGGAGCCTGG + Intronic
909466575 1:75980128-75980150 CCTCATCAGCAGCTGCTGCTTGG - Intergenic
910448594 1:87324959-87324981 CCTCAGCATCCCCAGCAGCTGGG + Intergenic
911062420 1:93759776-93759798 CCTCAGCAGCACCTCCTGTGTGG - Intronic
911590134 1:99737856-99737878 CCTCAGCCTCCCGTGCAGCCGGG + Intronic
911831286 1:102553824-102553846 CCTCTGCCGCAGCTCCAGCCGGG - Intergenic
912129781 1:106587128-106587150 ACTCAGCAGCAGCCGTAGCCAGG + Intergenic
912548066 1:110465532-110465554 CCCCAGCAGCTCCTGCAGTGGGG - Intergenic
913264840 1:117034104-117034126 CCCAAGAGGCACCTGCAGCCAGG + Exonic
913966486 1:143381467-143381489 GCACATCAGCACCTGCAGCTGGG - Intergenic
914060861 1:144207074-144207096 GCACATCAGCACCTGCAGCTGGG - Intergenic
914118289 1:144759295-144759317 GCACATCAGCACCTGCAGCTGGG + Intergenic
914730124 1:150362752-150362774 CCTCAGCAGCACAAGTAGCTGGG - Intergenic
915178771 1:154040286-154040308 CCTCAGCATCACAAGCAGCTGGG - Intronic
915321757 1:155060407-155060429 CCTCTGCAGCCCCTGCCACCTGG + Intronic
915355796 1:155254770-155254792 CGTAAGCAGGGCCTGCAGCCAGG + Exonic
915544937 1:156591809-156591831 GCCCAGCAGCGCCCGCAGCCTGG - Exonic
915584515 1:156837098-156837120 CCTCAGCTGCAGCTGATGCCTGG - Intronic
916804477 1:168244790-168244812 CTCCAGCAGCTCCAGCAGCCTGG + Exonic
916809857 1:168295911-168295933 ACTGTCCAGCACCTGCAGCCAGG - Intronic
916961022 1:169890050-169890072 CCCCAGCAGTACTGGCAGCCTGG + Intronic
917069574 1:171135485-171135507 CTTCAGCTGAACCTGCAGCTAGG + Intergenic
917229672 1:172822471-172822493 CCTCAGCACCCCCAGCAGCTGGG - Intergenic
917345134 1:174021960-174021982 CCTCCGCGGCAGCGGCAGCCCGG - Intronic
917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG + Intergenic
919306914 1:195853224-195853246 CCTCAGCAGCAATAGCAGCAAGG - Intergenic
919664891 1:200282569-200282591 CCTGAACCACACCTGCAGCCTGG + Intergenic
919787424 1:201268702-201268724 CCTCAGCAGCAGCTGCTGCAGGG + Intergenic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920430747 1:205917336-205917358 GCTCAGCATCCCCTGGAGCCTGG + Exonic
920674824 1:208031552-208031574 GCTCAGCAGGAGGTGCAGCCTGG - Intronic
920933681 1:210411637-210411659 CCTCAGCCTCCCCTGCAGCTGGG - Intronic
921060220 1:211578884-211578906 CCTCAGCAGCCCCCACACCCAGG + Intergenic
922575559 1:226658855-226658877 CCTTACCAGCCCCTGCAGACCGG + Intronic
924363576 1:243266430-243266452 CCTCAGCCTCCCCAGCAGCCAGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924949342 1:248867825-248867847 CCCCAGCAGACCCTGGAGCCAGG + Intergenic
1062793738 10:326433-326455 CCTCACCAGCACCTGCTGAGAGG + Intronic
1066010507 10:31189836-31189858 CCCAAGCAGCACCCACAGCCTGG + Intergenic
1066259051 10:33711265-33711287 CCTCAACAGCAACTGCACACAGG + Intergenic
1066415170 10:35214839-35214861 CCTCAACAGAACCTGCAGTAGGG + Intergenic
1067045085 10:42980985-42981007 CCACAGCACCACGTGCAGCAGGG + Intergenic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1067785120 10:49240181-49240203 CCTGAGCAGCTCATGAAGCCCGG - Intergenic
1069624716 10:69860670-69860692 CCTGGGCAGAACCTGCAGCCAGG + Intronic
1069894574 10:71672567-71672589 CCTGATCAGCATCCGCAGCCTGG + Intronic
1070142873 10:73751713-73751735 CGTCAGCAGTACCTGTAACCTGG - Intronic
1070215521 10:74375676-74375698 CCTCAGCAGCACCAGGAGAGTGG + Intronic
1070804368 10:79262235-79262257 CATCAGCAGCACCTGAGACCTGG + Intronic
1071471093 10:85984492-85984514 GCTCCCCAGCACCTGCAGGCAGG + Intronic
1071562442 10:86654879-86654901 CCAGAGCAGCATCTCCAGCCTGG + Exonic
1072570561 10:96654465-96654487 CCTCAGCAGCCCCAGGAGCCAGG - Intronic
1073192148 10:101659178-101659200 CCCAAGCAGCACCTGCAGAGGGG + Intronic
1074842454 10:117368969-117368991 CCTCAGCATCCCCAGCAGCTGGG + Intronic
1075437388 10:122455108-122455130 CATCAGAAGCACCTGAAGGCTGG - Intronic
1075662369 10:124206909-124206931 GCTCAGCTTCACCTGCAGCCAGG - Intergenic
1075726946 10:124615504-124615526 CCCCGGCATCACCCGCAGCCCGG - Intronic
1076016906 10:127034999-127035021 TCTCAGCAGCAGCTGTTGCCAGG + Intronic
1076096449 10:127737548-127737570 CCTCAGCAGCTCCTGCTGGCCGG - Exonic
1076238979 10:128888020-128888042 CCTCTGCAGCCCATGGAGCCTGG - Intergenic
1076417236 10:130300689-130300711 TCCCAGCAGCGCCTGCAGGCAGG - Intergenic
1076526820 10:131117290-131117312 CTGCAGCAGCACCTGAGGCCTGG - Intronic
1076607027 10:131695771-131695793 CCTCGGCAGCACTTGCATTCTGG + Intergenic
1076947103 10:133658895-133658917 CCTCAGCCTCCCCAGCAGCCCGG + Intergenic
1077021647 11:419704-419726 GGTCTCCAGCACCTGCAGCCAGG + Exonic
1077058648 11:608171-608193 CCTCGGCAGCCACTGCACCCCGG - Exonic
1077074095 11:692219-692241 CTTCAGCAGCATCTGCACACAGG + Intronic
1077110809 11:861255-861277 CCACAGGAGCACCTGCCACCCGG - Intronic
1077305047 11:1865183-1865205 CCTGAGCAGAGGCTGCAGCCTGG + Exonic
1077422302 11:2458508-2458530 CCTCACCAGGAGCTGGAGCCTGG - Intronic
1077494802 11:2881781-2881803 CCACAGCTGCATCTGCTGCCAGG - Intergenic
1077864271 11:6210283-6210305 CGTCAGCCCCAGCTGCAGCCAGG - Exonic
1078514307 11:12009234-12009256 CCGCATCTGCACCCGCAGCCCGG - Intronic
1078801094 11:14644392-14644414 GCTCAGCAGCGTCCGCAGCCAGG - Exonic
1079294592 11:19221669-19221691 CCTCAGCAACAGTTGCAGCAGGG + Intergenic
1079324624 11:19481026-19481048 GATCCGTAGCACCTGCAGCCCGG + Intronic
1079414842 11:20224226-20224248 CCTCAGGAACCCCTGGAGCCAGG + Intergenic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1080457119 11:32427984-32428006 CGACAGCTGCACCGGCAGCCAGG - Exonic
1080676817 11:34435622-34435644 CCTCAGCCTCACGTGCAGCTGGG + Intergenic
1081609980 11:44556070-44556092 CCTCACCTGGCCCTGCAGCCAGG + Intergenic
1082784922 11:57311498-57311520 CCTCCGGAGCAGCTGCAGCTTGG + Intronic
1082996943 11:59262393-59262415 CTCCAGCAGCAGCTGCACCCTGG - Intergenic
1083669393 11:64291757-64291779 CCTCAGCCGCAGCCGCAGCGGGG + Intronic
1083678960 11:64342607-64342629 CCTCAGCTCCTCCTGCAGGCGGG - Exonic
1083782805 11:64926724-64926746 GCTCAGCAGCTCGTGCAGCTCGG - Exonic
1083967444 11:66051419-66051441 CCTCAGCCGCACCTGCACTGGGG - Intronic
1084213760 11:67635731-67635753 CTTCAGCAGCACCGGGAGGCAGG - Intronic
1084315634 11:68343770-68343792 CCCCAGGAGCTCCTGCATCCTGG + Intronic
1084422637 11:69068008-69068030 CCTCGGCAGCAACCGCAGCGTGG - Intronic
1084427759 11:69094854-69094876 CCCCAGCAGCACCTGTTGCCAGG + Intergenic
1084506983 11:69574577-69574599 CCTCAGCAACAGGTACAGCCAGG - Intergenic
1084630665 11:70346553-70346575 CCTCTGCAGCATCTGTTGCCAGG + Intronic
1084692243 11:70734170-70734192 CCCCTGCCGCACCTGCTGCCCGG - Intronic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1085616513 11:78003961-78003983 CCTCAGCAGCCCAAGTAGCCAGG - Intergenic
1086113412 11:83222374-83222396 CCTCAGCACCACATGTAGGCAGG - Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1089518300 11:119047636-119047658 CCACAGCAGCCCCTGCCTCCTGG - Intronic
1090083040 11:123627046-123627068 CCTCAACAGGCCCTGGAGCCAGG + Intronic
1091073249 11:132588770-132588792 CCACAGCTTCACCTGTAGCCAGG + Intronic
1091281526 11:134384289-134384311 TCTGAGCAGCCCCTGCAGCGGGG - Intronic
1091320275 11:134644660-134644682 ACACAGCAGCACCTGCTGCCCGG + Intergenic
1093809535 12:23474754-23474776 CCTCAGCCCCACCAGCATCCTGG + Intergenic
1094686105 12:32716445-32716467 CCTCAGCCTCACCTGTAGCTAGG + Intronic
1095945157 12:47749525-47749547 GGTCACCAGCCCCTGCAGCCAGG + Exonic
1095981501 12:47977111-47977133 CCTCAGGACCAGCTGGAGCCCGG - Exonic
1096505007 12:52087188-52087210 CCTCTGCAGCCCCTCCACCCCGG + Intergenic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1096870803 12:54590901-54590923 CCCCAGCACCAGCTGCTGCCGGG - Intergenic
1097082598 12:56443853-56443875 CCTGAGCAGGGCCTTCAGCCTGG + Intronic
1097867187 12:64568578-64568600 CCACAGCAGGAGCTGCAGTCAGG + Intergenic
1097955239 12:65478675-65478697 CCTCAGCCTCACCTGTAGCTGGG + Intronic
1100232081 12:92618814-92618836 CCTCAGCAGTGGTTGCAGCCAGG - Intergenic
1101030009 12:100649005-100649027 TCTTAGCAGAAGCTGCAGCCTGG + Intergenic
1101365278 12:104064749-104064771 CCTCCGCAGCTCCAGCAGGCGGG - Intronic
1102191184 12:110989750-110989772 CCTCAGCATCCCGGGCAGCCGGG - Intergenic
1102349849 12:112184327-112184349 CCTGTGCAGCACCGGCAGCCTGG - Exonic
1102428820 12:112865571-112865593 CCTGTGCAGCACCTGCAGAGGGG + Intronic
1102438526 12:112944139-112944161 AGTCAGCAGTGCCTGCAGCCTGG - Intronic
1102513181 12:113429238-113429260 CCTCTGCACCACCTGCAGGGAGG - Exonic
1102913733 12:116737789-116737811 CCTCAGCAGCACCTTCAAGCAGG - Exonic
1102929686 12:116852639-116852661 CTTCAACAGCATCTGCAGGCAGG - Intronic
1103384653 12:120522702-120522724 CCTAAGCTGGAGCTGCAGCCTGG + Intronic
1103396662 12:120612352-120612374 ACTCAGCAGTAGCTGTAGCCAGG - Intergenic
1103479827 12:121243920-121243942 CCACCACAGCACCTGCAGCAGGG + Intronic
1103715769 12:122944593-122944615 CCTCACCTCCCCCTGCAGCCTGG - Intronic
1104356321 12:128090016-128090038 CCCCAGCAGCACAGGAAGCCAGG - Intergenic
1104644319 12:130486236-130486258 CCTCAGCAGCACCCGACACCAGG + Intronic
1104682748 12:130762539-130762561 CCTCCGCAGGGCCTCCAGCCTGG - Intergenic
1104684683 12:130777173-130777195 CCTCAGCCTCCCCAGCAGCCAGG + Intergenic
1104857354 12:131908395-131908417 TCTCTGGAGCAGCTGCAGCCCGG + Intronic
1105292413 13:19061434-19061456 CCCCAGCACCACCAGCTGCCAGG + Intergenic
1105605950 13:21926677-21926699 TCTCACCAGCACCCCCAGCCAGG - Intergenic
1106123732 13:26882995-26883017 CTCCAGCAGGACCTGGAGCCTGG - Intergenic
1106255059 13:28014817-28014839 CCTCAGAGGCACCTGCTTCCCGG - Intronic
1106701877 13:32237861-32237883 CAGCAGCAGCTGCTGCAGCCCGG - Exonic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107471110 13:40692104-40692126 TCTCAACAGCAATTGCAGCCTGG + Intergenic
1108039931 13:46330659-46330681 CCAGAGCAGCAAGTGCAGCCTGG + Intergenic
1109183973 13:59247418-59247440 CCTTTGCAGCCTCTGCAGCCTGG - Intergenic
1109479129 13:62926078-62926100 CCTCAGCCTCCCCAGCAGCCGGG - Intergenic
1111397099 13:87677819-87677841 CCGCAGCTGCAGCTGCAGCCCGG + Exonic
1112124128 13:96446055-96446077 CCTCAGCATCCCCAGCAGCTGGG - Intronic
1112435099 13:99386179-99386201 CCTGAGGAGAACCTGCTGCCAGG - Intronic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113804571 13:113105895-113105917 CCCCGGACGCACCTGCAGCCAGG - Exonic
1113968142 13:114166397-114166419 TCTCAGCAGCCCTTGGAGCCTGG - Intergenic
1114407053 14:22466780-22466802 CAACAGCAGCACCTGCAGCGTGG + Intergenic
1114479653 14:23024758-23024780 TCTCAGGAGCCCCTGCAGTCAGG - Intronic
1114536342 14:23425383-23425405 CTCCAGCAGCCCCAGCAGCCCGG + Exonic
1114648007 14:24266440-24266462 CAGTAGCAGCTCCTGCAGCCGGG + Exonic
1114802370 14:25792063-25792085 GATCAGCAGCACCTGCATCTTGG - Intergenic
1117107642 14:52414658-52414680 CCTCAGCCTCACCAGCAGCTGGG - Intergenic
1117548588 14:56812171-56812193 CCTCTGCAGCAGCTCCAGTCCGG + Intergenic
1117622121 14:57598094-57598116 CCTCAGGAACACCTGGAACCAGG + Intronic
1117776365 14:59188747-59188769 CCTGAGCAGCCCCTGCATGCTGG - Intronic
1117868196 14:60171061-60171083 CCACTGCAGCACCTCCAGCCTGG + Intergenic
1117882185 14:60323125-60323147 CCTCAGAAACAACTGGAGCCGGG + Intergenic
1118678292 14:68212431-68212453 CAACAGCAGCACCAGCAGCAAGG + Intronic
1119321901 14:73737099-73737121 CCTCATCAAGACCTCCAGCCTGG + Exonic
1119659730 14:76441709-76441731 TATCACCAGCACCTACAGCCTGG - Intronic
1120949754 14:90030165-90030187 GCTCGGCAGCACCTGCCCCCAGG - Intronic
1121604081 14:95227613-95227635 CCTCAGCAGCAGCAGCAAACAGG + Intronic
1121612542 14:95291486-95291508 CCCCAGCCGCACCTGCAACCTGG - Intronic
1121738893 14:96237705-96237727 CATAGGCAGCACCTGCAGCAGGG - Intronic
1122182984 14:99969430-99969452 CCTCAGCAGCACCTGCCAGATGG + Intergenic
1122347732 14:101070958-101070980 CCCCAGCAGAGCCTGCAGTCTGG - Intergenic
1122399136 14:101457386-101457408 CCACGGCGGCAGCTGCAGCCCGG - Intergenic
1122937553 14:104967059-104967081 CCCCAGCTGCACCTGCTGCCAGG - Intronic
1123006336 14:105325571-105325593 GCTCAGCAGCCCCAGGAGCCAGG + Intronic
1202921167 14_KI270723v1_random:31450-31472 CCTCAGCCTCTCCAGCAGCCCGG + Intergenic
1202923743 14_KI270724v1_random:6130-6152 CCTCAGCCTCCCCAGCAGCCCGG - Intergenic
1123736576 15:23190354-23190376 CCTCAGCCTCCCGTGCAGCCGGG + Intergenic
1124064958 15:26333729-26333751 CTTCTGCTGCACCTGCATCCTGG - Intergenic
1125435960 15:39645660-39645682 GGGCAGCAGCAGCTGCAGCCAGG - Intronic
1125598581 15:40903097-40903119 CCTCTGCAGCTCCTCCAGCCGGG - Exonic
1125828386 15:42694255-42694277 ACTCTGCAGCACCTGGAGCAGGG - Exonic
1125931244 15:43601502-43601524 CCTGAGCAGATCCTGCAGCTTGG - Exonic
1125932970 15:43613108-43613130 CCACAGCAGCTCCTGGGGCCAGG + Exonic
1125944399 15:43701320-43701342 CCTGAGCAGATCCTGCAGCTCGG - Intergenic
1125946069 15:43712570-43712592 CCACAGCAGCTCCTGGGGCCAGG + Intergenic
1126038526 15:44569529-44569551 CATCAGCATCACCTGGAGTCTGG + Intronic
1127104514 15:55598924-55598946 CCTCAGCACCCCCAGCAGCTGGG + Intergenic
1127377472 15:58398179-58398201 GGTAAGCAGCCCCTGCAGCCAGG - Intronic
1128214802 15:65926937-65926959 CCTCTGCAGTATCTCCAGCCTGG - Intronic
1128959941 15:71991867-71991889 CCTCAGCCTCACCAGCAGCTGGG + Intronic
1129035717 15:72647350-72647372 CCTCCGATGCACCTGCAGCAAGG - Intergenic
1129053440 15:72801602-72801624 CTTGTGCAGCTCCTGCAGCCTGG + Intergenic
1129214167 15:74089866-74089888 CCTCCGATGCACCTGCAGCAAGG + Intergenic
1129249905 15:74303073-74303095 CCTCAGCACCACCTGGTGGCAGG + Intronic
1129331951 15:74832338-74832360 CCTCCGCAGCATCAGCAGCAAGG + Intergenic
1129391256 15:75222065-75222087 CCTCCGATGCACCTGCAGCGAGG - Intergenic
1129399842 15:75275503-75275525 CCTCCGATGCACCTGCAGCAAGG - Intronic
1129473055 15:75765801-75765823 CCTCCGATGCACCTGCAGCAAGG + Intergenic
1129814599 15:78540623-78540645 CCTCGGCGGCAACTGCAGGCCGG - Intronic
1129880472 15:79003394-79003416 CGTCAGCAGCTCCTGCCCCCTGG - Intronic
1130886438 15:88096442-88096464 CCTCAGCAGCACCTGCCTCTGGG - Intronic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1131072732 15:89476384-89476406 CATCAGCATCACCTACAGACTGG - Intronic
1132031824 15:98444794-98444816 CCATGGCAGCACCTGAAGCCTGG + Intronic
1132573833 16:655879-655901 CCACAGCATCACCTGCCTCCAGG - Exonic
1132590594 16:724735-724757 CTTGAGCTGCAGCTGCAGCCGGG + Exonic
1132650181 16:1017700-1017722 CCTCACCAACACCTACAGCCTGG + Intergenic
1132760638 16:1507109-1507131 CCTCAGCCTCACCTGCGCCCAGG + Intronic
1132802304 16:1760433-1760455 CCTCAGCACCTCCTGCTCCCCGG - Exonic
1133076617 16:3285177-3285199 GCCTAGCAGCTCCTGCAGCCTGG - Exonic
1133313720 16:4868829-4868851 CCTCAGCAGCTCTGGCAGCCTGG - Exonic
1134135439 16:11673839-11673861 CCTCAGGGGCCACTGCAGCCAGG - Intronic
1134653013 16:15925722-15925744 CCTCAGCAGCTCCTGAACCATGG - Intergenic
1134786973 16:16953357-16953379 CCTCAGGAGCACCTTCAAGCAGG - Intergenic
1135147435 16:19974840-19974862 ACTCAGCAGCAGCAGTAGCCTGG + Intergenic
1136234655 16:28906038-28906060 CCTCAGCTGCCCCTCCAGGCTGG + Exonic
1136395615 16:29991187-29991209 CCTGGGCAGCAGCTTCAGCCGGG - Intronic
1136552252 16:30987981-30988003 CCGCAGCAGCCACTGCAGCAGGG - Exonic
1136676623 16:31914221-31914243 CCTCAGCAGCATCTGCATGGCGG - Intronic
1137231524 16:46571466-46571488 CCTCATCAGCATCTCCCGCCTGG - Intergenic
1138537317 16:57666933-57666955 CCTCACCCTCACCTGCAGCTGGG + Intergenic
1138577770 16:57919439-57919461 CCTCAACAGCAACAGCAACCTGG + Intronic
1138855776 16:60689527-60689549 CCTCAGCAGCAAAGGCTGCCAGG + Intergenic
1139451465 16:67030543-67030565 CCTCATCAGCACCTCCAACAAGG - Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140504838 16:75464680-75464702 CCTCAGCGTCACCTCCAGCCGGG + Exonic
1141690135 16:85592020-85592042 GCTAAGTAGCACCTGCGGCCAGG + Intergenic
1142236001 16:88922843-88922865 CCTCGGCAGCACCCCCACCCAGG + Intronic
1142311593 16:89317370-89317392 AGTCAGCAGCACCTGGATCCTGG + Intronic
1143078618 17:4365905-4365927 CCCCGGCAGCACCTGAACCCGGG + Intronic
1143185052 17:5004947-5004969 CATCAGCAGTTCCCGCAGCCGGG - Exonic
1143323828 17:6085582-6085604 CCTCAGAAGCATGTACAGCCTGG + Intronic
1143586175 17:7851656-7851678 CTTCAGCAGCTCCTGCAGCTGGG - Exonic
1143680435 17:8472148-8472170 CCTCAGCAGCACCGGCCTCTGGG + Intronic
1143760339 17:9098315-9098337 CTCCAGCAGTGCCTGCAGCCAGG + Intronic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1143972120 17:10803455-10803477 CCCCAGCAGGACCTGAGGCCAGG + Intergenic
1144565983 17:16359738-16359760 CCTCAGCAGCCCCTGTAGCTGGG + Intergenic
1144785395 17:17828439-17828461 CCTCAGCAGCACCTGCGAGATGG + Intronic
1144849713 17:18237921-18237943 TCTCAGTACCACCTGCAGCTGGG + Intronic
1145185504 17:20790623-20790645 CCTCAGCATCTCCTGTAGCTAGG + Intergenic
1145283914 17:21489566-21489588 CCTGACCAGGACCTGCACCCAGG - Intergenic
1145904350 17:28508055-28508077 CCTCGGCAGGCCCTGGAGCCGGG - Intronic
1146022914 17:29293878-29293900 CCTCACCAATACCTGCAGCATGG - Exonic
1147162927 17:38578456-38578478 CCGCAGCCGCAGCCGCAGCCGGG + Intronic
1147352700 17:39864139-39864161 CCACAGCGGCAGCTCCAGCCCGG - Exonic
1147378137 17:40035150-40035172 CCTCAGCAGCACCAAGAACCGGG - Exonic
1147535081 17:41315553-41315575 CCGCAGCAGCCACAGCAGCCCGG + Exonic
1147722404 17:42547217-42547239 CCTCAGCATCACCCTCAGCACGG - Intergenic
1147723590 17:42553387-42553409 CCTCAGCATCACCCTCAGCACGG - Intronic
1147906467 17:43826373-43826395 CATCAGCATCACCTGGAGGCAGG + Intronic
1148217084 17:45839228-45839250 GCTAAGCAGCACCTGATGCCCGG - Intergenic
1148235367 17:45964980-45965002 CCCCAGCAGCACCAACTGCCAGG - Intronic
1149598482 17:57877949-57877971 CCTAGGCAGGACTTGCAGCCTGG - Intronic
1149655136 17:58305910-58305932 GCGCTGCAGCACCTGCAGCCTGG - Intronic
1149706717 17:58701390-58701412 CCTCAGCCTCCCCAGCAGCCGGG - Intronic
1149989211 17:61371749-61371771 CCACAGCAGCATCCGTAGCCAGG + Intronic
1150249770 17:63699271-63699293 CCTGGGCGGCTCCTGCAGCCTGG + Exonic
1151392622 17:73797837-73797859 GCTCAGCAGCCACTGCAGCTTGG - Intergenic
1151399891 17:73849117-73849139 CCTGAGCATGTCCTGCAGCCTGG + Intergenic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1152293917 17:79455830-79455852 CTGCAGCGGCACCTCCAGCCTGG + Intronic
1152417442 17:80171751-80171773 CCTCACCAGCAGCTGAAGACAGG - Intronic
1152427484 17:80226040-80226062 CATCAGCAGCACCTGCAAGCTGG + Intronic
1152441242 17:80311548-80311570 TCACAGCAGCACCTGCATCCTGG + Intronic
1152524388 17:80879299-80879321 GCCCAGCAGGAGCTGCAGCCGGG - Intronic
1152580668 17:81164356-81164378 CCTCACCAGCACCAGCACCTTGG + Intronic
1152600899 17:81261695-81261717 CCTCAGCAGCACCTGGCGTCCGG - Intronic
1152660666 17:81540478-81540500 CCGCAGCAGCCCCTGAGGCCAGG - Exonic
1152674192 17:81628992-81629014 CCTCAGCCTCACCAGCAGCTGGG + Intronic
1152730710 17:81968269-81968291 TCTAAGGAGCAACTGCAGCCAGG - Intergenic
1152809487 17:82374842-82374864 CAGCAGCAGCGCCAGCAGCCAGG - Exonic
1152841289 17:82570375-82570397 CCTCAGCCGCCCCAGCAGCTGGG - Intronic
1152896671 17:82915247-82915269 CCTCCGGGGCACCTGCGGCCAGG - Intronic
1152929170 17:83101202-83101224 CCTGAGCTGCAGCTGCAGCGAGG - Intergenic
1153354373 18:4119205-4119227 CCTCAGCCTCCCCTGCAGCTGGG + Intronic
1153369217 18:4295004-4295026 CCTCATCTGCTCCTGGAGCCTGG + Intronic
1153783680 18:8515780-8515802 TATCAGCAGCTCCTGGAGCCTGG - Intergenic
1154068596 18:11131984-11132006 ACTCAGCAGCGGCTGCAGCCAGG - Intronic
1154252436 18:12755783-12755805 CCTCAGCAGCGGCCGTAGCCAGG + Intergenic
1155788139 18:29927796-29927818 CCTCAGCATCCCCTGTAGCTGGG - Intergenic
1156294029 18:35773881-35773903 CCTCAGGGGCCCCAGCAGCCTGG + Intergenic
1156351985 18:36309684-36309706 CCTCAGCAGCACCATGTGCCTGG + Intronic
1158467064 18:57699957-57699979 CCTGAGCAGCCCCTGCAGTGGGG + Intronic
1158506557 18:58051140-58051162 CCTCAGCCTCCCCAGCAGCCAGG - Intronic
1158522640 18:58184388-58184410 TCTCAGCAGCACCTCCAGTGAGG - Intronic
1158536115 18:58309554-58309576 CCTCATCAGCTCCTTCAGGCAGG - Intronic
1158920589 18:62187295-62187317 CCTCTGCTGCACCAGCAGCCCGG - Exonic
1159436899 18:68429752-68429774 CCTGAGAAACACCTGCTGCCTGG + Intergenic
1160178352 18:76613857-76613879 GCTCAGCAGCCCCTGCCGCGAGG - Intergenic
1160410344 18:78671488-78671510 TCTCAGAAACACCTGAAGCCAGG - Intergenic
1160463428 18:79056448-79056470 CCTCAGGAGGACCTGTAGCTGGG + Intergenic
1160609519 18:80074417-80074439 CATCAGCAGCAGCTCCAGGCTGG - Intronic
1161060399 19:2211811-2211833 GCCCAGCAGCTCCTGCAGGCTGG - Exonic
1161133161 19:2603666-2603688 CATCAGAAGCCCCTGCAGCTAGG + Intronic
1161431129 19:4233061-4233083 CCTCAGCACCTCCTACTGCCGGG - Intronic
1161446106 19:4320164-4320186 CCTCAGCAGTAGCTGAGGCCTGG + Intronic
1161591072 19:5129277-5129299 CCCCAACAGACCCTGCAGCCAGG - Intronic
1161975622 19:7606528-7606550 CTCCAGCAGCCCCTGCAGACGGG + Exonic
1162084533 19:8240547-8240569 ACTCACCCGCCCCTGCAGCCTGG - Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162943808 19:14030720-14030742 CTTCATCAGCATCTGCATCCGGG - Exonic
1163114690 19:15181673-15181695 CCTGAGCAACCCCTGCGGCCCGG - Exonic
1163563905 19:18038315-18038337 CCTCAGCCGCCCCAGCAGCTGGG + Intergenic
1164161430 19:22627825-22627847 TCTCAGCAGCAGCAGCAGCTTGG + Intergenic
1164558419 19:29270878-29270900 CCTGAGCAGAACCTGGGGCCTGG - Intergenic
1164680655 19:30131732-30131754 CCCCATCAGCACCAGCTGCCCGG - Intergenic
1165112210 19:33509071-33509093 CCTGTGCAGGTCCTGCAGCCAGG - Intronic
1165436163 19:35796760-35796782 CCACAGATGTACCTGCAGCCAGG + Intergenic
1165911291 19:39229926-39229948 TCTCACCACTACCTGCAGCCTGG + Intergenic
1166086623 19:40480133-40480155 CCTCAGCCTCACGTGCAGCTGGG - Intronic
1166786461 19:45370232-45370254 ACCCAGCAGCCCCTGCCGCCAGG - Exonic
1167101907 19:47408905-47408927 CCTGAGCGGCACCTGCACTCAGG + Intronic
1167386722 19:49168044-49168066 ACGCAGCAGGTCCTGCAGCCAGG - Exonic
1167465550 19:49649348-49649370 ACCCAGCAGCAGGTGCAGCCTGG + Intronic
1167582879 19:50356839-50356861 CCTCAGCCTCACGTGTAGCCGGG - Intronic
1167874494 19:52400074-52400096 TCTCAGCATCAGCAGCAGCCAGG - Intronic
1168149285 19:54436187-54436209 CCACCCCAGCTCCTGCAGCCGGG + Intronic
1168253387 19:55154099-55154121 CCCCAGCAGCGCCTGCATCATGG + Exonic
1168678815 19:58298924-58298946 CCTCAGCCGCCCCTGTAGCTGGG + Exonic
1202700269 1_KI270712v1_random:158962-158984 GCACATCAGCACCTGCAGCTGGG - Intergenic
925860491 2:8170780-8170802 CCTCAGCAGCACCTTCCACATGG + Intergenic
925860791 2:8173258-8173280 CCTCCCCAGCCCCAGCAGCCAGG - Intergenic
926144105 2:10386446-10386468 CCTGCCCAGCATCTGCAGCCAGG - Intronic
926147401 2:10405079-10405101 GCTCAGTAGAACCTGCAGGCAGG + Intronic
926294219 2:11556446-11556468 CCTCAGCTGCAGCTACTGCCGGG - Exonic
927146453 2:20169428-20169450 TCCCAGCAGGCCCTGCAGCCTGG - Intergenic
927211342 2:20640868-20640890 CCACAGCTGCCTCTGCAGCCTGG - Intronic
927298672 2:21484848-21484870 CCTAAGCAGGACCTACAGCCCGG - Intergenic
927809933 2:26175232-26175254 CCTCCCCACCAGCTGCAGCCCGG + Intronic
927915550 2:26933871-26933893 CCTCACCAGCACCTGGGGCGGGG - Intronic
927930637 2:27041344-27041366 CCTCACCTCCACCTGAAGCCTGG + Exonic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
929297332 2:40263207-40263229 CCTCAGCTTCACCTGCAGAATGG + Intronic
929779232 2:44947059-44947081 CCCCAGCAGCACCAGCACCAGGG + Intergenic
930179477 2:48338515-48338537 CCTCAGCCTCCCCAGCAGCCGGG + Intronic
930921100 2:56754740-56754762 CCTCACCAGCAGCTGATGCCAGG - Intergenic
931033901 2:58215208-58215230 CCTCAGCAGGAACTGCTGCTAGG + Intronic
931087480 2:58849093-58849115 CCTCAGCCGCACCAGTAGCTGGG - Intergenic
931665687 2:64608478-64608500 CCTCAGCTTCTCCAGCAGCCAGG - Intergenic
932405600 2:71511069-71511091 CCTCAGCAGGATCTGCAGCCTGG - Intronic
932595280 2:73089469-73089491 TCTCAGCTGCATCTGAAGCCTGG - Intronic
932606006 2:73166143-73166165 TCTCAGCAGCAGCCGCGGCCTGG + Intergenic
932975797 2:76598101-76598123 ACTCAGCAGTACCTGTAGCCAGG - Intergenic
933375706 2:81477529-81477551 CCTCAGCCTCCCCTGCAGCTGGG + Intergenic
933409781 2:81910428-81910450 CCTCATCTGCTCCTGGAGCCTGG + Intergenic
933926420 2:87094307-87094329 TCTCAGCAGCAGCCGCAGCCTGG - Intergenic
934171202 2:89542438-89542460 GCACATCAGCACCTGCAGCTGGG - Intergenic
934281508 2:91616756-91616778 GCACATCAGCACCTGCAGCTGGG - Intergenic
934616207 2:95772809-95772831 CCTCAGCAGCCTCTCCTGCCTGG - Intergenic
934644688 2:96051751-96051773 CCTCAGCAGCCTCTCCTGCCTGG + Intergenic
934662516 2:96150625-96150647 GCACAGCAGCAGCAGCAGCCGGG + Intergenic
934838103 2:97607841-97607863 CCTCAGCAGCCTCTCCTGCCTGG + Intergenic
935200645 2:100853739-100853761 CCCCAGGGGCATCTGCAGCCAGG + Intronic
936247698 2:110842968-110842990 CCTCAGCAGCTGCAGCAGCCTGG - Intronic
936594163 2:113831886-113831908 CCTCAGCCTCCCCTGCAGCTGGG + Intergenic
936758908 2:115749851-115749873 CCCCAGCATCACCTGCAGACAGG - Intronic
936907778 2:117556719-117556741 ACTCCCCTGCACCTGCAGCCTGG - Intergenic
936928829 2:117765614-117765636 CCTCACCACCACCTCCAACCTGG + Intergenic
937024635 2:118687993-118688015 TCTCAGCATGACCTGCAGCTTGG - Intergenic
937321785 2:120965398-120965420 CTGCTGCAGCACCTGCATCCTGG - Intronic
937321842 2:120965664-120965686 CTGCCGCAGCACCTGCATCCCGG - Intronic
937335769 2:121061556-121061578 CCTCAGGATCACCTGCAGTCAGG - Intergenic
938083045 2:128380441-128380463 CCTCAGGAGCCGCTGCAGCACGG - Intergenic
938088406 2:128416878-128416900 CCTCTGCAGCCCCATCAGCCAGG + Intergenic
938228489 2:129637757-129637779 CCTCAGCAGCCTCTGCTGCCTGG + Intergenic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
939356727 2:141111928-141111950 CCTCAGCACCCCCAGCAGCTGGG - Intronic
940018055 2:149127500-149127522 ACTTAGCAGCACCTGCTCCCAGG + Intronic
940168961 2:150806000-150806022 CCTCAGCAACAACTGTATCCAGG - Intergenic
940359400 2:152781438-152781460 ACTCAGCAGTGGCTGCAGCCAGG + Intergenic
940867734 2:158833999-158834021 CCTCAGCCTCCCCAGCAGCCGGG - Intronic
941011242 2:160302308-160302330 CCTCAGCTTCCCCTGCAGCTGGG + Intronic
941967873 2:171317756-171317778 CCTCAGCTGCCCCTGGAGCTCGG - Exonic
942453517 2:176122909-176122931 CATCAGCCACACCTGCAGGCCGG - Exonic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
946185933 2:217980327-217980349 CCTCAGCACCACCACCAGCCCGG + Intronic
946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG + Intergenic
947156223 2:227164746-227164768 CAGCAGGAGCACCTGCGGCCTGG - Exonic
947829250 2:233127098-233127120 CCTCATCAGCCCCTCCATCCTGG + Intronic
947944755 2:234092020-234092042 CGTCAGCAGCTGCAGCAGCCAGG - Intergenic
948140818 2:235670621-235670643 CCACAGCAGCTCCGGGAGCCTGG + Intronic
948306276 2:236949281-236949303 ACTCCGCAGCCCCCGCAGCCCGG + Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948542813 2:238702432-238702454 CCCCAGCTGCAGCTGCAGGCCGG + Intergenic
948698570 2:239746765-239746787 CCACAGCTGCAGCTCCAGCCGGG - Intergenic
948819917 2:240537178-240537200 CCCCACCCTCACCTGCAGCCAGG + Intronic
948954176 2:241273778-241273800 CCTCAACAGCACCCGTGGCCTGG - Intronic
1169135193 20:3193032-3193054 CCCCAGCAGCACCTCAGGCCAGG - Intronic
1169156273 20:3332567-3332589 CCTCAGCACCCCCAGCAGCTGGG + Intronic
1169873320 20:10270378-10270400 CTTCAGCATCACCTGAAGGCTGG + Intronic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1170749210 20:19130488-19130510 CGTGAGCTGCACCTGCAGCCAGG - Intergenic
1170810244 20:19668812-19668834 CCACAGCACCACCTACATCCGGG - Intronic
1170986763 20:21266095-21266117 CATCTGCAGCACATGCAGCAAGG + Intergenic
1172048856 20:32101148-32101170 CCTCAGCTTCACTTGCAGCTAGG - Intronic
1172483500 20:35285305-35285327 TCTCTCCAGCACCTGCAGCCTGG - Intergenic
1173923895 20:46766147-46766169 CCACACCTGCACCTGCAACCTGG + Intergenic
1173955273 20:47027440-47027462 CCTGTGCAACACCTCCAGCCTGG + Intronic
1174046793 20:47739458-47739480 CCTCAGCCGTACCCCCAGCCTGG + Intronic
1174404699 20:50295809-50295831 CCCCAGCATCATGTGCAGCCTGG + Intergenic
1174431787 20:50475354-50475376 CCTCAGCCTCCCCAGCAGCCGGG - Intergenic
1174476632 20:50800433-50800455 CCTCAGCAGCTCCTCCATCTGGG - Intronic
1175224238 20:57435690-57435712 CCTCAGCGCCACCTGGAGCTTGG + Intergenic
1175250759 20:57609046-57609068 CCTTAGCATCGACTGCAGCCTGG + Intronic
1175270230 20:57728685-57728707 CCTCCCCAGCACCTGCACACAGG + Intergenic
1175338824 20:58214574-58214596 CTCCAGCAGCCTCTGCAGCCGGG - Intergenic
1175424448 20:58854806-58854828 CCTCTGCAGCCCCTGCCTCCGGG + Exonic
1175571610 20:60027022-60027044 CCACAGCAGCAAATGGAGCCAGG + Intronic
1175740906 20:61419212-61419234 TCTCAGCTGCACCTGCTGCGGGG - Intronic
1175834306 20:61983545-61983567 CCTCAGCCGCCCCAGTAGCCTGG - Intronic
1175891696 20:62318622-62318644 GCTCAGCTGCTCCTGCACCCGGG + Exonic
1175911449 20:62407163-62407185 CCTCCGCAGCGCCTGCGGCGGGG + Exonic
1175954993 20:62604650-62604672 CATCAGTGGGACCTGCAGCCGGG + Intergenic
1176370434 21:6058915-6058937 CCCCAGCTCCATCTGCAGCCTGG - Intergenic
1178470511 21:32888147-32888169 CCTCAGGAACACCTGCCTCCAGG - Intergenic
1179632892 21:42689425-42689447 CCTCAGCACCAGCTCCAGCCTGG + Intronic
1179753085 21:43479626-43479648 CCCCAGCTCCATCTGCAGCCTGG + Intergenic
1179887251 21:44319466-44319488 CCACTGCAGCACATGCTGCCTGG - Intronic
1179909384 21:44439845-44439867 CCGCTGCAGCCCCTGCTGCCTGG - Intronic
1179912504 21:44457545-44457567 GCACAGCAGCACCTCCAGGCTGG + Exonic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180825218 22:18856800-18856822 CCACAGGGGCACCTGCAGGCTGG + Intronic
1180959776 22:19757278-19757300 CCTGAGCAGGACCTGCAGGCAGG - Intronic
1181046591 22:20217528-20217550 CCTCAAACGCTCCTGCAGCCTGG - Intergenic
1181187511 22:21117747-21117769 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1181211687 22:21292746-21292768 CCACAGGGGCACCTGCAGGCTGG + Intergenic
1181397822 22:22634140-22634162 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1181422772 22:22813279-22813301 ACTCAGCAGTAGCTACAGCCAGG + Intronic
1181500567 22:23313510-23313532 CCACAGGGGCACCTGCAGGCTGG - Intronic
1181651587 22:24261918-24261940 CCACAGGGGCACCTGCAGGCTGG + Intergenic
1181705788 22:24648821-24648843 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1181863885 22:25840320-25840342 CTTCAGCAGCTCCTTCTGCCTGG + Intronic
1181964702 22:26648183-26648205 CCCCAGCAGGTGCTGCAGCCTGG - Intergenic
1182434128 22:30319490-30319512 ACTCAGCAGACCCAGCAGCCTGG - Intronic
1183174417 22:36212470-36212492 CCCCGGCACCACCTTCAGCCCGG + Intergenic
1183744809 22:39686189-39686211 GTTCAGCAGCACCAGCAGCCTGG + Exonic
1183945859 22:41325296-41325318 CCCCAGCCCCACCTCCAGCCTGG - Intronic
1183948320 22:41339110-41339132 CCTCCCCAGCACCGACAGCCTGG + Exonic
1184073786 22:42163312-42163334 GTTCCTCAGCACCTGCAGCCTGG + Intronic
1184075534 22:42174917-42174939 CCTCAGCCGCCCCAGCAGCTGGG - Intronic
1184267829 22:43359185-43359207 TCCCAGCTGCACCTGCAGCCTGG - Intergenic
1184510382 22:44929938-44929960 CCCCTGCAGCACCTGCAACCAGG + Intronic
1184534622 22:45077992-45078014 CCTCGGCACCACCTGCTCCCAGG - Intergenic
1184596815 22:45518909-45518931 CCACTGCAGCACCCGCAGCCTGG - Intronic
1184597591 22:45523586-45523608 CCTCAGCCTCACCGGCAGCTGGG - Intronic
1184601605 22:45547098-45547120 CAGCAGCAGCCCCTGTAGCCAGG + Exonic
1184678187 22:46054553-46054575 GCCCCGCAGCACCTGCAGCAGGG + Intronic
1184707530 22:46224738-46224760 CCCCAGCAGCCCCTGCAGGGAGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184977659 22:48074410-48074432 CCTCAGCTCCACCTTCAGACTGG - Intergenic
1184979315 22:48084885-48084907 CCTCTGCAGCTGCAGCAGCCAGG - Intergenic
1185137921 22:49083825-49083847 CCCCAGCACCTCCTGCATCCAGG - Intergenic
1185146616 22:49140685-49140707 CCACTGCAGCAAATGCAGCCCGG + Intergenic
1185310390 22:50151044-50151066 CGTCAGCAGAAACTGCAGCCTGG + Intronic
1185322717 22:50209308-50209330 CCCCTGGAGCAGCTGCAGCCAGG + Intronic
1185327493 22:50234198-50234220 CCACAGCAGCATCTACACCCAGG + Intronic
1185327594 22:50234669-50234691 CCACAGCAGCATCTACACCCAGG + Intronic
1203215266 22_KI270731v1_random:2686-2708 CCACAGGGGCACCTGCAGGCTGG - Intergenic
1203275364 22_KI270734v1_random:82703-82725 CCACAGGGGCACCTGCAGGCTGG + Intergenic
950580236 3:13857322-13857344 CCTCAGCAGCACTCAAAGCCTGG - Intronic
950831521 3:15879738-15879760 GCTCAGCATCCCCTGCAGTCAGG + Intergenic
952166004 3:30749706-30749728 CCTGAGAAGCACCTGAAGGCAGG + Intronic
952225778 3:31374385-31374407 TCTCAGCCTCTCCTGCAGCCAGG + Intergenic
953612049 3:44455145-44455167 CCTCTGCAGCTCCTCCAGCAAGG + Exonic
953805017 3:46061309-46061331 GCTCAGCAGAGGCTGCAGCCAGG + Intergenic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
953854267 3:46488937-46488959 GGTCTGCTGCACCTGCAGCCTGG + Intergenic
954149280 3:48649204-48649226 GCACAGCAGCACCTGGAGGCAGG + Exonic
954532689 3:51334428-51334450 CTTCAGCAGCAACTGGATCCAGG - Intronic
954605861 3:51908722-51908744 CCACAGCAGCACAGGGAGCCAGG + Intergenic
955387418 3:58491277-58491299 GCTCAGCAACACGGGCAGCCAGG - Intergenic
955778805 3:62462242-62462264 CTTCAGCAGCAGTAGCAGCCTGG - Intronic
955971064 3:64439040-64439062 CCTCTGCAGCAACTGCATCCCGG + Intronic
956306992 3:67836532-67836554 ACTCAGCAGTAGCTGTAGCCAGG - Intergenic
957028117 3:75208547-75208569 CAGCAGCATCACCTGAAGCCTGG - Intergenic
957080356 3:75631521-75631543 CCTCAGCCTCCCCAGCAGCCCGG - Intergenic
959377337 3:105602789-105602811 CCTCAGCAGTGGCTGTAGCCAGG + Intergenic
959997995 3:112699221-112699243 TCTCAGCAGTGGCTGCAGCCAGG - Intergenic
960639608 3:119813094-119813116 CCCCAGCAGCACTGGCTGCCCGG - Intronic
961465829 3:127081058-127081080 CCACAGCTGCACCTGCATGCTGG - Intergenic
961528376 3:127523681-127523703 CCTCAGCACCCTCTGCATCCAGG - Intergenic
961644804 3:128387157-128387179 CCCCTGCAGCCCCTGCGGCCAGG - Intronic
963106594 3:141652795-141652817 CCTCAGCATCACCTGGTGTCAGG - Intergenic
965671711 3:171154421-171154443 CCCCAGAAGCACCTGCTCCCTGG - Intronic
966390885 3:179451398-179451420 GCTCAGCAGCCCCTGGAGCGCGG + Exonic
967915266 3:194573729-194573751 CCTCACCAGCACAGGGAGCCAGG - Intergenic
968222433 3:196948620-196948642 CCCCAGCAGCTCCTGCCGCTCGG - Exonic
968446259 4:653841-653863 CCACAGCAGCACCTGGAGGGAGG - Exonic
968500194 4:946305-946327 GCTGAGCCCCACCTGCAGCCAGG - Intronic
968615559 4:1576017-1576039 TCCCAGCAGCATCTGCAGCTGGG + Intergenic
968673860 4:1866515-1866537 CCACAGCAGCACCTGGAGTTGGG + Intergenic
968728581 4:2259504-2259526 CCTCAGCCCAAACTGCAGCCTGG + Intronic
968871657 4:3245711-3245733 GCTCTGCAGCCCCAGCAGCCTGG + Intronic
968899044 4:3422272-3422294 CCTCCCCAGCACGTGCGGCCTGG + Intronic
968904723 4:3445948-3445970 CCTCTGCAGCGCCTCCTGCCGGG + Intronic
969028567 4:4193450-4193472 GCACATCAGCACCTGCAGCTGGG + Intronic
969257431 4:6011752-6011774 ACTCAGCAGCAGCTGCAGTTGGG - Intergenic
969798463 4:9544051-9544073 GCTCAGCGGGAGCTGCAGCCAGG - Intergenic
970016767 4:11520671-11520693 CAGCAGCAGCACATTCAGCCTGG - Intergenic
970195608 4:13547677-13547699 GCGCAGCAGCACCCCCAGCCCGG - Intergenic
971100889 4:23465519-23465541 ACTCAGCAGTAGCTGCAGCCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972381634 4:38525156-38525178 GCTCAGCAGCCAGTGCAGCCAGG - Intergenic
973286352 4:48421129-48421151 CCTCAGCACCCCCTGTAGCTGGG + Intronic
973759110 4:54100756-54100778 CATCATCAGCCCCAGCAGCCTGG + Exonic
974433494 4:61828749-61828771 CATCAGCAACAGCTGGAGCCTGG + Intronic
974564908 4:63569212-63569234 CCTCAGCAGTGGCTGTAGCCTGG - Intergenic
975770121 4:77711476-77711498 CCTCAGAACCAGCTGCAGCAAGG + Intergenic
976198522 4:82557350-82557372 CTTCAGCTGCTCCTGGAGCCAGG + Intronic
976511191 4:85911116-85911138 CTGCAGCTGCACCTGCACCCAGG + Intronic
976897404 4:90128247-90128269 CCGCCTCAGCACCCGCAGCCCGG - Intronic
978701770 4:111655374-111655396 CCTCAGCCGCCCCAGCAGCTGGG + Intergenic
979890189 4:126082418-126082440 CCTCAGCCTCCCCGGCAGCCTGG - Intergenic
980156172 4:129109635-129109657 CCTCAGCATGAACTGCAGCAAGG + Exonic
983064017 4:163189668-163189690 AGGCAGCACCACCTGCAGCCCGG - Intergenic
984130155 4:175864925-175864947 CCTCCCCAGCAGCTGCAGCTGGG + Intronic
984839190 4:184052299-184052321 CCAGAGCATCACCTGCAGCCCGG + Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985315965 4:188659226-188659248 CCTGCCCAGCGCCTGCAGCCCGG - Intergenic
985450564 4:190059694-190059716 CCTCAGCCTCCCCAGCAGCCCGG + Intergenic
985662216 5:1162899-1162921 CCTGAACAGAACCTGCTGCCAGG - Intergenic
985672123 5:1212502-1212524 CCTCTGGAGCACCTGCAGCCTGG - Intronic
985722804 5:1499366-1499388 CCACAGCACCACATTCAGCCAGG + Intronic
985898476 5:2765174-2765196 CCACATCAGCACCTGCACTCTGG + Intergenic
986006660 5:3673974-3673996 CCTCAGCACCCCCGGCAGCTGGG + Intergenic
986543097 5:8868100-8868122 TCTCAGCATCAACTGCAGGCTGG + Intergenic
987251726 5:16107727-16107749 CCTCATCTGCTCCTGGAGCCTGG - Intronic
987767162 5:22247557-22247579 CCTCAGCCTCTCCTGCAGCTGGG - Intronic
990080291 5:51904222-51904244 CCTCAGCCTCCCCAGCAGCCGGG - Intergenic
990989946 5:61674921-61674943 TCTCAGCACCTCCAGCAGCCTGG + Intronic
991677833 5:69106220-69106242 CCACAGTAGCAGCTGCAGCTTGG + Intronic
993496191 5:88611721-88611743 CCTCACCAGATGCTGCAGCCTGG + Intergenic
995774273 5:115709081-115709103 CCTCAGCAGGACATGCACTCTGG + Intergenic
995776154 5:115726798-115726820 ACTCAGCAGCGGCTGTAGCCAGG + Intergenic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
996595905 5:125202448-125202470 TCTCAGCCTCACCTGCAGCTAGG + Intergenic
997733131 5:136194930-136194952 CCTCACCAGGACTTTCAGCCAGG + Intergenic
998555544 5:143119651-143119673 GCTAAGCAACACCTGCAGCAGGG - Intronic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
999155707 5:149456093-149456115 CCTGAGCAGAACACGCAGCCGGG + Intergenic
1001313498 5:170627375-170627397 CCTCACCAGGACCAGCACCCTGG + Intronic
1001365525 5:171134804-171134826 CCTCAGCCTCCCCTGTAGCCGGG - Intronic
1002424233 5:179166235-179166257 CCACAGCAGCACCGGGAGCCTGG + Intronic
1002443576 5:179276541-179276563 ACACAGGAGCACATGCAGCCTGG + Intronic
1002459993 5:179368585-179368607 CCTCGTCACCACCTCCAGCCAGG + Intergenic
1002837533 6:877709-877731 CCTCAAAACCACCTGCAGCTGGG - Intergenic
1002888054 6:1312938-1312960 CCGCTGCAGCAGCTGCTGCCGGG - Exonic
1003307679 6:4944507-4944529 TAACAGCAGCACCCGCAGCCAGG + Intronic
1003381238 6:5626248-5626270 CCTCATCTGGACCTGCAGGCTGG - Intronic
1003563304 6:7201841-7201863 CCCCAGAAGAACCTGCAGCATGG - Intronic
1004285431 6:14316709-14316731 CCTCAGCATCCTCTGCAGTCCGG + Intergenic
1004489926 6:16104821-16104843 TCTCAGCAGCAACTCCAGCTGGG + Intergenic
1004720983 6:18266820-18266842 CCTCAGCAGCTGCTCCAGACAGG + Intergenic
1005375483 6:25178078-25178100 GCTCATCAGCACATGAAGCCTGG + Intergenic
1006073763 6:31516168-31516190 GCCCAGGAGCACCTGCAGGCAGG - Intergenic
1006611687 6:35297993-35298015 CCACACCAGCCCCTGCCGCCTGG + Intronic
1006635325 6:35457566-35457588 CTTCAGCAGCTGCTGCAGCCTGG - Exonic
1006908385 6:37548138-37548160 GCTCAGCTGCATCTGGAGCCAGG + Intergenic
1007110528 6:39310950-39310972 CCTCAGCAACACCACCAGCATGG - Exonic
1007224457 6:40303091-40303113 CACTTGCAGCACCTGCAGCCAGG + Intergenic
1007791795 6:44313294-44313316 CGTCAGTGGCAGCTGCAGCCCGG - Exonic
1012466609 6:99522665-99522687 CCTCAGCCTCACCGGTAGCCGGG - Intergenic
1014070402 6:117175358-117175380 CCTCAGCAGCAGCCCCAGTCAGG + Intergenic
1014133613 6:117863316-117863338 CCCCGGCAGCACCTGCTACCCGG - Intergenic
1014290936 6:119557728-119557750 CCCCAGCAGCACCGTCAGCATGG + Intergenic
1015768490 6:136744643-136744665 CCTCACCAGCACCTACACCAGGG + Intronic
1015823230 6:137284633-137284655 CCCCAGCTGCACATGCAGCCTGG + Intergenic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1017539313 6:155384129-155384151 GCTCAGCAACACTCGCAGCCAGG + Intergenic
1019186544 6:170223873-170223895 TCTGAGGAGCACCTCCAGCCGGG + Intergenic
1019190596 6:170248607-170248629 CCTCCGAGGCAGCTGCAGCCTGG + Intergenic
1019210443 6:170400609-170400631 CCTCCACAGCACCAGCATCCAGG + Intronic
1019378284 7:707897-707919 CACCAGCACCACCTGGAGCCGGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019623440 7:2003552-2003574 CCACGGGAGCACCTGGAGCCTGG - Intronic
1019979159 7:4608427-4608449 CCTCAGCCTCACCAGCAGCTGGG + Intergenic
1020000636 7:4753793-4753815 CCAGAGCCTCACCTGCAGCCGGG + Intronic
1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG + Intergenic
1020096127 7:5370624-5370646 ACTCGGCAGCACCTGCTTCCTGG - Exonic
1020270474 7:6591857-6591879 CTTGAGCAGTACCTGAAGCCAGG - Exonic
1020987777 7:15157525-15157547 TATCACCAGGACCTGCAGCCTGG - Intergenic
1021397899 7:20172923-20172945 CCACAGCACCACCTGGTGCCAGG + Intronic
1021684178 7:23165883-23165905 CTTCTGCAGCACATGCAGCAAGG - Exonic
1023018060 7:35985393-35985415 CCTCTGCAGCTGCTGAAGCCAGG - Intergenic
1024136335 7:46412655-46412677 CCTCAGCAGCATCTGGAGTGGGG + Intergenic
1024185811 7:46946741-46946763 TCTCACCAGCACCTGCCTCCTGG + Intergenic
1024325217 7:48104100-48104122 CCTCAGCCTCACCAGCAGCTGGG - Intronic
1024539948 7:50468097-50468119 CCTCCCCAGCACCTGCAACATGG - Intronic
1024774475 7:52766455-52766477 CCTCAGCCGCCCCAGCAGCTGGG - Intergenic
1026735804 7:72947931-72947953 CCTCAGCTGCACACGCAGCCAGG - Intronic
1026786147 7:73302862-73302884 CCTCAGCTGCACACGCAGCCAGG - Intronic
1026798664 7:73382919-73382941 CCTCAGCATCCCCTGCTGCTGGG - Intergenic
1026809491 7:73450917-73450939 CCCAAGCAGCACGTGCATCCTGG + Exonic
1027107930 7:75417132-75417154 CCTCAGCTGCACACGCAGCCAGG + Exonic
1028762503 7:94510484-94510506 CCTCAGCAGCACTTTTGGCCAGG - Intronic
1029194832 7:98797959-98797981 CCTCAGCCTCACAAGCAGCCTGG - Intergenic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029737600 7:102473311-102473333 CCGCAGCAGCCCCTGGACCCCGG + Exonic
1032017988 7:128392067-128392089 ACTCAGCAACTCCTGCAGCCAGG - Intergenic
1032313081 7:130806571-130806593 CCTCAGCATCACCTGCAAACTGG - Intergenic
1034202956 7:149294006-149294028 CCCCAGCAGCACCTTCATCTGGG - Intronic
1034857991 7:154571973-154571995 TCTCAGATGCAACTGCAGCCCGG - Intronic
1034962671 7:155372453-155372475 GCGCCGCAGCACCTGCATCCTGG - Intergenic
1035055041 7:156029419-156029441 CCGCAGCCCCTCCTGCAGCCTGG - Intergenic
1035148289 7:156842776-156842798 CCTCAGCAGTGCTGGCAGCCTGG + Intronic
1035785610 8:2258029-2258051 CCTCAGGGACAGCTGCAGCCAGG + Intergenic
1035807197 8:2463687-2463709 CCTCAGGGACAGCTGCAGCCAGG - Intergenic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1038017765 8:23529455-23529477 CCTCAGCGCCGCCAGCAGCCGGG - Intronic
1038029912 8:23628859-23628881 CCTCAGCACCCCCAGCAGCTGGG - Intergenic
1038270075 8:26067862-26067884 CCACAGTATCAACTGCAGCCTGG + Intergenic
1040277700 8:46022339-46022361 ATTCAGCATCACCTTCAGCCTGG + Intergenic
1041098696 8:54374735-54374757 CATCAGCAGCATCTCCTGCCTGG - Intergenic
1041832993 8:62178298-62178320 CCTCAGCATCCCCAGCAGCTGGG - Intergenic
1042395973 8:68292591-68292613 CCGCAGCAGCACCGGTAGCGGGG - Intergenic
1043356752 8:79422820-79422842 CATCAGCAGCACCTGAGGGCTGG + Intergenic
1044962337 8:97542988-97543010 CCTCGGCAGGACTGGCAGCCTGG - Intergenic
1045112651 8:98948927-98948949 CCTCAGCACCCCCAGCATCCCGG + Exonic
1046128544 8:109940695-109940717 ACTCAGCAGTAGCTGCAGTCAGG + Intergenic
1047381891 8:124372131-124372153 CCTCAGCAGCGGCAGCAGCCGGG + Exonic
1047690507 8:127348853-127348875 CCACAGCAGCAGCAGCACCCAGG + Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048072863 8:131040220-131040242 CCACAGCAGCCGCTGCGGCCGGG + Exonic
1048363746 8:133720292-133720314 CATGGGCAGCACCTGCAGCGGGG - Intergenic
1049036602 8:140081163-140081185 CCTCAGCAGCACACTCTGCCTGG + Intronic
1049047185 8:140162024-140162046 CCGCAGCAGCCCCAGCAGACCGG + Intronic
1049260507 8:141636463-141636485 TCTCGGCAGCAGCTGCAGCAGGG - Intergenic
1049434387 8:142579722-142579744 CCTCAGAGGCAGGTGCAGCCCGG - Intergenic
1049649615 8:143759426-143759448 CCTCAGCAGCACCTTCAGGCAGG - Intergenic
1049683510 8:143930211-143930233 GCTCAGCAGCTCCGGCAGCGAGG - Exonic
1049776560 8:144408621-144408643 CCGCAGCAGCACTTGCTGCAGGG + Intronic
1049969419 9:808225-808247 CCTCTGCAGTGGCTGCAGCCTGG + Intergenic
1051175703 9:14357397-14357419 CCTTTGCAGCACCTGAGGCCAGG - Intronic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1052944934 9:34160753-34160775 GCTCAGCAGCAGCTCCAGGCTGG - Intergenic
1053013306 9:34647572-34647594 CCCCAGCAGCAGTTGGAGCCAGG - Intronic
1053149782 9:35736111-35736133 CAGCAGCAGCACCTGCATCTTGG + Exonic
1053180245 9:35962277-35962299 CCTAAGCAGCAGCTGCTGCTGGG - Intergenic
1053455047 9:38227216-38227238 CCGCAGCTGCAGCTACAGCCAGG + Intergenic
1055391505 9:75826772-75826794 CCTCAGCAGCATCAGTAGCAAGG + Intergenic
1055515899 9:77032592-77032614 CCTCAGGGGCACCTGCTGACTGG - Intergenic
1055639760 9:78310554-78310576 CCTAAGCAGCACCTGGAGGAGGG - Intronic
1055728510 9:79257423-79257445 CCTCTTCAGCACCTGCCTCCTGG - Intergenic
1055914990 9:81391781-81391803 CCCCAGCACCAACTGCAGCAAGG + Intergenic
1056495097 9:87148482-87148504 TCGCAGCTGCGCCTGCAGCCAGG + Intergenic
1056873729 9:90307709-90307731 CCTCAGCTGCTCCTATAGCCTGG - Intergenic
1057198917 9:93130123-93130145 CCTCAGCAGCACTCGGGGCCTGG + Intronic
1057294595 9:93827810-93827832 CCGCAGCTGCACCGGCTGCCTGG - Intergenic
1057704235 9:97386370-97386392 CCTGCCCAGCACCTGCAGTCTGG + Intergenic
1058912534 9:109534180-109534202 CATCAGCAGCACCTGCCGGCGGG - Intergenic
1060525857 9:124321016-124321038 TCTGAGGAGCACCTGCAGGCTGG + Intronic
1060841104 9:126793739-126793761 CCTCAGCCTCCCTTGCAGCCAGG + Intergenic
1060996819 9:127878704-127878726 CCTCAGCAACCACAGCAGCCAGG + Intergenic
1061026690 9:128054432-128054454 CCTCAGCAGGGCCTGGAGGCAGG + Intergenic
1061289163 9:129641118-129641140 CCCCGGCAACACCTGCAGCCAGG + Intronic
1062277087 9:135736297-135736319 CCTCTCCAGCATCTGCCGCCCGG + Intronic
1062430618 9:136525467-136525489 CCTCAGCGGCCCCAGCGGCCCGG + Intronic
1062497432 9:136838354-136838376 TCTCTGCAGCACCTGGATCCTGG - Intronic
1203781716 EBV:104721-104743 CCTCCGCAGCCGCTGAAGCCAGG + Intergenic
1185533305 X:839097-839119 CTTCAGCAGGATCTGCACCCTGG - Intergenic
1185533381 X:839437-839459 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533420 X:839607-839629 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533495 X:839947-839969 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533533 X:840117-840139 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1185533572 X:840287-840309 CTTCAGCAGGATCTGCATCCTGG - Intergenic
1187504686 X:19869333-19869355 CCTCAGACTCACCTGCAGCTGGG + Intronic
1187695305 X:21913382-21913404 CCTCAGCCGCACCAGTAGCTGGG - Intergenic
1188465295 X:30472753-30472775 TCCCAGCAGCCCCTGCAGCTAGG - Intergenic
1188586841 X:31786836-31786858 CCTCAGTAGCAACTGCAGTGTGG + Intronic
1189054645 X:37686030-37686052 CCTGAGCAGCACCTACCGCTCGG + Exonic
1190430182 X:50371371-50371393 CCTGCTCAGCACCTGCTGCCAGG - Intronic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1190797807 X:53760504-53760526 CCATGGCAGCCCCTGCAGCCAGG + Intergenic
1190917354 X:54820706-54820728 CCATGGCAGCCCCTGCAGCCAGG - Intergenic
1190931155 X:54950657-54950679 CCATGGCAGCCCCTGCAGCCAGG - Intronic
1190944005 X:55073088-55073110 CCCCAGTAGCACCTGGAACCCGG - Intergenic
1193198012 X:78657015-78657037 CCTCATCAGGCCCTGCAGGCGGG - Exonic
1193278336 X:79618200-79618222 TTTCAGCAGCATCTGCAGCAGGG - Intergenic
1196921679 X:120591734-120591756 CCTTAGAGGCAGCTGCAGCCTGG - Intergenic
1197761999 X:130034567-130034589 CCTCAGAGTCACCTACAGCCCGG + Intronic
1197831257 X:130645812-130645834 CCTCAGCACCACCTCCAGGCAGG + Intronic
1198466620 X:136909649-136909671 CCTCAGCAGCCACCTCAGCCCGG - Intergenic
1199300209 X:146204642-146204664 CCTGGGCCGCATCTGCAGCCAGG + Intergenic
1200397491 X:155999668-155999690 CCCCAGAAGCAGCTGGAGCCTGG - Intronic
1202332080 Y:23764981-23765003 CCTCAGCAGCACTTCCTGACTGG - Intergenic
1202538689 Y:25905079-25905101 CCTCAGCAGCACTTCCTGACTGG + Intergenic