ID: 904633346

View in Genome Browser
Species Human (GRCh38)
Location 1:31860190-31860212
Sequence GCATCAACCCGACTGGGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904633346_904633351 18 Left 904633346 1:31860190-31860212 CCTTAACCCAGTCGGGTTGATGC No data
Right 904633351 1:31860231-31860253 AATCCTTTTTTACATTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904633346 Original CRISPR GCATCAACCCGACTGGGTTA AGG (reversed) Intergenic
No off target data available for this crispr