ID: 904636357

View in Genome Browser
Species Human (GRCh38)
Location 1:31884585-31884607
Sequence GAGGAGAAGCCTACTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904636350_904636357 30 Left 904636350 1:31884532-31884554 CCTCTGGCTGCCATGAGAATAGA No data
Right 904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG No data
904636352_904636357 20 Left 904636352 1:31884542-31884564 CCATGAGAATAGACTGTAGTGGG No data
Right 904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904636357 Original CRISPR GAGGAGAAGCCTACTGTGGT CGG Intergenic
No off target data available for this crispr